Arge enodis

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records406

Data sources6

Biological traits0

DNA specimens20

eDNA detections20

Sources6 archives

Databases and archives Arge enodis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility406 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF406 records

Environmental DNA2 datasets · 6 countries20 detections

DNA & barcodingBOLD20 specimens

01Narrative

Larve, Mitte August Kokon Arge enodis ist eine Pflanzenwespe aus der Familie der Bürstenhornblattwespen. Sie ist eine von 18 Arten der Gattung in Deutschland.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge enodis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs3

Marker genes1

eDNA detections20

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 105 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

5Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

38Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Cmostly conserved

45Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

51Tmostly conserved

52Tmostly conserved

54Gmostly conserved

58Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Amostly conserved

78Gmostly conserved

79Tmostly conserved

80Tmostly conserved

81Cmostly conserved

82Amostly conserved

84Tmostly conserved

85Tmostly conserved

86Gmostly conserved

87Gmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Amostly conserved

100Amostly conserved

127Tmostly conserved

163Tmostly conserved

200Amostly conserved

202Cmostly conserved

205Cmostly conserved

206Tmostly conserved

212Tmostly conserved

214Amostly conserved

217Gmostly conserved

223Tmostly conserved

235Tmostly conserved

241Amostly conserved

263Cmostly conserved

265Tmostly conserved

284Cmostly conserved

305Amostly conserved

334Cmostly conserved

343Amostly conserved

346Tmostly conserved

352Tmostly conserved

354Tmostly conserved

361Amostly conserved

379Tmostly conserved

382Tmostly conserved

386Amostly conserved

421Tmostly conserved

433Avariable

442Tmostly conserved

478Amostly conserved

497Tmostly conserved

556Gvariable

586Amostly conserved

619Tmostly conserved

628Gvariable

631Gvariable

634Cmostly conserved

637Amostly conserved

640Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAATAGGACTATCATTTAGAATAATTATTCGAACAGAATTAAGTTCAGTTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes6

BINs3

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge ustulatasame genus7.3%Arge melanochrasame genus7.4%Arge macleayisame genus7.5%Arge ciliarissame genus7.6%Arge cyrasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type406 records

Wild obs. + sensor174

Museum / vouchered225

Other7

Range

Area of Occupancy AOO1 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 32≤1 km 18≤10 km 96

146 georeferenced · 28 without coordinates

Open the mapobservation + sensor174

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 7≤1 km 99≤10 km 51>10 km 3

160 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence225

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	94
Muzeum Górnośląskie w Bytomiulocation not on record	30
Zürich, CH	24
Helsinki, FI	20
ZSMlocation not on record	10
MZLUlocation not on record	10
Tilburg, NL	7
Gothenburg, SE	6
Bonn, DE	5
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
SLU Artdatabankenlocation not on record	2
Nijmegen, NL	1
Philadelphia, US	1
NHMOlocation not on record	1
Ugentlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

16 institutions · 215 of 225 vouchered records shown · 10 without an institution code

09Environmental DNA20 detections

Where the DNA of Arge enodis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map6 countries0

Floodplain forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 12.4–18.4

Seasonal swing summer↔winter18.8 °C

Max temp (day)21.5 °C 16.7–22.8

Min temp (night)12.2 °C 7.70–13.9

Precipitation81.9 mm/mo 57.9–121

Air humidity58.6 % 57.4–60.6

Moisture balance-39.9 mm/mo -55.6–4.40

Vapour deficit799 Pa 585–872

Wind speed3.50 m/s 2.60–4.10

Cloud cover34.8 % 31.6–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)