Arge dimidiata

(Fallén, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records772

Data sources6

Biological traits0

DNA specimens26

eDNA detections28

Sources6 archives

Databases and archives Arge dimidiata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF772 records

Environmental DNA2 datasets · 3 countries28 detections

DNA & barcodingBOLD26 specimens

01Narrative

Arge dimidiata is een vliesvleugelig insect uit de familie van de Argidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1808 door Fallen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge dimidiata has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections28

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.2%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 54 variable positions, in barcode order

14Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

38Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Cmostly conserved

45Tmostly conserved

46Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

51Tmostly conserved

52Tmostly conserved

54Gmostly conserved

58Amostly conserved

62Amostly conserved

63Tvariable

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Amostly conserved

78Gvariable

80Tmostly conserved

81Cvariable

82Tvariable

84Tvariable

86Gmostly conserved

87Gmostly conserved

88Gmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Amostly conserved

100Amostly conserved

385Tmostly conserved

535Gmostly conserved

550Tmostly conserved

TACATTATATTTCATTTTTGGGATTTGAGCAGGAATAATAGGACTTTCATTTAGAATAATTATTCGTACAGAATTAAGTTCTGTGGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge fuscipessame genus8.4%Arge sorbisame genus8.4%Arge nigripessame genus8.5%Arge clavicornissame genus8.5%Arge ciliarissame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type772 records

Wild obs. + sensor311

Museum / vouchered458

Cultivated / captive1

Other2

Range

Area of Occupancy AOO1 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 50≤1 km 48≤10 km 181>10 km 4

283 georeferenced · 28 without coordinates

Open the mapobservation + sensor311

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 12≤1 km 24≤10 km 365>10 km 8

409 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence458

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	357
Oulu, FI	18
SLU Artdatabankenlocation not on record	9
Provincia di Livornolocation not on record	7
Tilburg, NL	5
ZSMlocation not on record	3
Tartu, EE	3
Bonn, DE	3
Nijmegen, NL	1
BioFokuslocation not on record	1
Stockholm, SE	1
Metsähallituslocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
MZLUlocation not on record	1

14 institutions · 411 of 458 vouchered records shown · 47 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA28 detections

Where the DNA of Arge dimidiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys2

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.8–18.2

Seasonal swing summer↔winter24.9 °C

Max temp (day)17.2 °C 12.8–22.4

Min temp (night)10.5 °C 8.10–13.6

Precipitation72.9 mm/mo 52.2–122

Air humidity58.1 % 56.8–60.0

Moisture balance-37.1 mm/mo -58.7–1.20

Vapour deficit690 Pa 523–845

Wind speed2.90 m/s 2.40–4.50

Cloud cover46.9 % 34.5–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)