Arctosa stigmosa

(Thorell, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records115

Data sources7

Biological traits5

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Arctosa stigmosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

World Spider Trait DBMasaryk University5 traits · 13 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements13 literature sources5 traits

Occurrence & distributionGBIF115 records

DNA & barcodingBOLD3 specimens

01Narrative

Arctosa stigmosa is a wolf spider species found in Europe (France, Norway to Ukraine) and Iran.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 13 sources

LGBl 2015Nature and Landscape Protection Act 2002Liste France 2018Henriksen & Hilmo 2015Staręga et al. 2001Gajdoš & Svatoň 2001Gajdoš et al. 2014Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀7.3·♂5 mm

Predation1

Hunting guildground hunters

Ecology3

Legal protectionYes

Regional IUCN Red List categoryData Deficient (DD)

Regional non-IUCN Red List categoryEndangered (2)

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa stigmosa has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.71%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 7 variable positions, in barcode order

163Avariable

268Avariable

313Avariable

346Cvariable

370Gvariable

517Avariable

592Tvariable

AACTTTGTATTTAATGTTTGGAGTTTGATCAGCTATAGTAGGTACTGCAATAAGAGTGTTGATTCGAATGGAATTAGGAAATTCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa leopardussame genus8.5%Dolomedes sulfureussame order9.6%Arctosa alpigenasame genus10.2%Arctosa lutetianasame genus10.8%Cupiennius chiapanensissame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor50

Museum / vouchered65

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 13≤1 km 3≤10 km 27

43 georeferenced · 7 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 25≤1 km 13≤10 km 5

43 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	21
Ekaterinburg, RU	12
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	8
NSMKlocation not on record	7
Bonn, DE	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Kawasaki Shi Tama Ku, JP	1

8 institutions · 52 of 65 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)