Arctosa alpigena

(Doleschall, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records1 093

Data sources10

Biological traits9

DNA specimens48

eDNA detections48

Sources10 archives

Databases and archives Arctosa alpigena's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 093 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

World Spider Trait DBMasaryk University9 traits · 17 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~2.83 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements17 literature sources9 traits

Occurrence & distributionGBIF1 093 records

Environmental DNA1 datasets · 7 countries48 detections

DNA & barcodingBOLD48 specimens

Genome at a glanceGoaT2.8 Gbp

01Narrative

Arctosa alpigena is a wolf spider species in the family Lycosidae with a holarctic distribution.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 17 sources

LGBl 2015Buchar & Růžička 2002SLU 2020Henriksen & Hilmo 2015Bruun & Lissner 2019Hyvärinen et al. 2019Harvey et al. 2017Noflatscher 1994Staręga et al. 2002Řezáč et al. 2015Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Finch 2004Nentwig et al. 2018Dondale & Redner 1990Cardoso et al. 2011

Morphometry3

Body length♀7.62·♂5.95 mm

Cephalothorax length♀3.65·♂3.34 mm

Cephalothorax width♀2.71·♂2.45 mm

Predation1

Hunting guildground hunters

Ecology5

Legal protectionYes

Light 2open

Moisture 2very humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryPotentially Threatened (4)

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa alpigena has left across the world's sequence archives.

At a glance

DNA specimens48

BINs2

Marker genes1

eDNA detections48

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

13Amostly conserved

25Avariable

31Tvariable

34Tvariable

76Avariable

103Tmostly conserved

190Amostly conserved

217Avariable

226Tmostly conserved

271Tmostly conserved

289Avariable

295Avariable

298Avariable

319Gvariable

328Avariable

361Gvariable

382Amostly conserved

433Avariable

472Avariable

475Gmostly conserved

490Gvariable

493Gvariable

514Amostly conserved

517Tvariable

520Avariable

526Gmostly conserved

538Amostly conserved

565Gvariable

577Avariable

580Avariable

586Gvariable

604Tvariable

628Avariable

631Amostly conserved

643Avariable

649Gvariable

652Tvariable

TACTTTATATTTAATATTTGGATTATGATCTGCTATAGCAGGTACTGCTATAAGAGTATTAATTCGTTTAGAATTAGGACATTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes17

BINs2

Most divergent pair5.2%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa insignitasame genus4.3%Dolomedes sulfureussame order9.0%Arctosa lutetianasame genus9.3%Hygrolycosa rubrofasciatasame family9.4%Melocosa fumosasame family9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Arctosa alpigena carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 826 420 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arctosa alpigena2.83 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 093 records

Wild obs. + sensor250

Museum / vouchered843

Origin

Native11

Range

Area of Occupancy AOO1 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 137≤1 km 79≤10 km 21>10 km 2

239 georeferenced · 11 without coordinates

Open the mapobservation + sensor250

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 168≤1 km 121≤10 km 117>10 km 11

417 georeferenced · 426 without coordinates

Open the institutions mapphysical evidence843

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	425
Edmonton, CA	142
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	52
University of Alberta Museums (UAM)location not on record	34
Denver, US	23
SLU Artdatabankenlocation not on record	21
Ekaterinburg, RU	14
Rovaniemi, FI	13
RMZlocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Cambridge, US	6
Musee d'Histoire Naturallelocation not on record	6
Albuquerque, US	4
Tartu, EE	2
University of Tokyo, Department of Zoologylocation not on record	2
WIlocation not on record	2
Bonn, DE	2
Vancouver, CA	2
Royal Saskatchewan Museumlocation not on record	2
University of Alaska Museumlocation not on record	2
BioFokuslocation not on record	1
NTNU-VMlocation not on record	1
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1
Frankfurt am Main	1
University of Oulu, Zoological Museumlocation not on record	1
MZLUlocation not on record	1

26 institutions · 775 of 843 vouchered records shown · 68 without an institution code

09Environmental DNA48 detections

Where the DNA of Arctosa alpigena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map7 countries0

ForestRiparian ZoneGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 3.80–15.0

Seasonal swing summer↔winter25.8 °C

Max temp (day)14.5 °C 7.00–19.4

Min temp (night)7.70 °C -1.70–11.5

Precipitation95.0 mm/mo 63.4–183

Air humidity60.6 % 56.1–65.2

Moisture balance-6.30 mm/mo -23.8–80.5

Vapour deficit556 Pa 276–709

Wind speed4.10 m/s 2.10–6.20

Cloud cover48.4 % 36.4–61.2

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arctosa alpigena

At a glance

Sources10 archives

Morphometry3

Predation1

Ecology5

At a glance

Genome sizehow big the whole instruction manual is

Record type1 093 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 093 records