Arctosa lutetiana

(Simon, 1876) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records3 656

Data sources8

Biological traits11

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Arctosa lutetiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 656 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University11 traits · 23 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements23 literature sources11 traits

Occurrence & distributionGBIF3 656 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

De tricca is een spinnensoort in de taxonomische indeling van de wolfspinnen (Lycosidae). Het dier behoort tot het geslacht Arctosa. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1876 door Eugène Simon.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 23 sources

Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014SLU 2020Bruun & Lissner 2019Henriksen & Hilmo 2015Blick & Scheidler 2004Řezáč et al. 2015Blick et al. 2016Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Komposch & Steinberger 1999Noflatscher 1994Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀7.95·♂9 mm

Predation2

Hunting guildground hunters

Simple hunting guild classificationcursorial

Ecology8

Ballooninghigh

Light0.75 mm

Light 2open

Moisture 10.5 mm

Moisture 2very dry

Regional IUCN Red List categoryVulnerable (VU)

Regional non-IUCN Red List categoryLeast Concern (*)

Stratumsurface

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa lutetiana has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

270Tvariable

561Gvariable

579Gvariable

ACTTTATATTTAGTGTTTGGAGTTTGATCATCTATAGTTGGTACTGCTATAAGAATAATAATTCGTATAGAATTAGGACATTCTGGAAGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa alpigenasame genus9.3%Hippasa deserticolasame family9.3%Hippasa lycosinasame family9.4%Hygrolycosa rubrofasciatasame family9.7%Navira naguansame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 656 records

Wild obs. + sensor2 130

Museum / vouchered1 514

Cultivated / captive1

Other11

Origin

Native922

Range

Area of Occupancy AOO1 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤100 m 79≤1 km 25≤10 km 1 801>10 km 2

1 907 georeferenced · 223 without coordinates

Open the mapobservation + sensor2 130

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 10≤1 km 15≤10 km 266>10 km 5

296 georeferenced · 1 218 without coordinates

Open the institutions mapphysical evidence1 514

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1 168
Paro, BT	86
Musee d'Histoire Naturallelocation not on record	21
	11
Ekaterinburg, RU	10
Uniwersytet w Białymstokulocation not on record	10
EIBElocation not on record	10
SLU Artdatabankenlocation not on record	7
Frankfurt am Main	6
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	6
Geneva, CH	4
Bonn, DE	4
Provincia di Livornolocation not on record	3
Washington, US	3
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	3
Bern, CH	2
ARTlocation not on record	2
Zoologisches Museum Hamburglocation not on record	1
Tartu, EE	1
Bavarian State Collection of Zoologylocation not on record	1

20 institutions · 1 359 of 1 514 vouchered records shown · 155 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Arctosa lutetiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Sandrasen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–13.2

Seasonal swing summer↔winter18.0 °C

Max temp (day)17.7 °C

Min temp (night)8.20 °C

Precipitation61.3 mm/mo

Air humidity58.4 %

Moisture balance-51.1 mm/mo

Vapour deficit635 Pa

Wind speed3.80 m/s

Cloud cover31.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arctosa lutetiana

At a glance

Sources8 archives

Morphometry1

Predation2

Ecology8

At a glance

Record type3 656 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 656 records