Arctosa insignita

(Thorell, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records388

Data sources8

Biological traits3

DNA specimens162

eDNA detections156

Sources8 archives

Databases and archives Arctosa insignita's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility388 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI156 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics162 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF388 records

Environmental DNA1 datasets · 3 countries156 detections

DNA & barcodingBOLD162 specimens

01Narrative

Arctosa insignita is een spinnensoort in de taxonomische indeling van de wolfspinnen (Lycosidae). Het dier behoort tot het geslacht Arctosa. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1872 door Tord Tamerlan Teodor Thorell.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀8.9·♂6.8 mm

Cephalothorax length♀3.69·♂3.55 mm

Cephalothorax width♀2.81·♂2.69 mm

05DNA & barcoding162 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa insignita has left across the world's sequence archives.

At a glance

DNA specimens162

BINs2

Marker genes2

eDNA detections156

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus153 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

13Amostly conserved

58Gmostly conserved

100Amostly conserved

112Amostly conserved

175Amostly conserved

214Gvariable

265Gmostly conserved

286Amostly conserved

298Gvariable

328Gmostly conserved

335Gmostly conserved

370Avariable

436Amostly conserved

535Gvariable

538Gvariable

539Tmostly conserved

559Amostly conserved

580Gmostly conserved

586Gmostly conserved

652Cvariable

TACTTTATATTTAATATTTGGATTGTGATCTGCTATAGCAGGTACTGCTATAAGAGTGTTGATTCGTTTAGAATTAGGACATTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes28

BINs2

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa alpigenasame genus4.3%Hygrolycosa rubrofasciatasame family10.0%Pardosa parvulasame family10.9%Pardosa saxatilissame family11.1%Pardosa xerophilasame family11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type388 records

Wild obs. + sensor1

Museum / vouchered387

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 166≤1 km 3≤10 km 23

192 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence387

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
AU-Biosciencelocation not on record	133
University of Guelph, Centre for Biodiversity Genomicslocation not on record	66
Edmonton, CA	56
Denver, US	16
WIlocation not on record	9
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Copenhagen, DK	1

8 institutions · 285 of 387 vouchered records shown · 102 without an institution code

09Environmental DNA156 detections

Where the DNA of Arctosa insignita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found156

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 156 detections have coordinates

Open the map3 countries0

Forest4. Native Grassland | 4.1. Tundraalpine area with talus screeFell-field in the high mountains1. Forest & Woodland | 1.1. Boreal Foresttalus scree

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 5.60–13.2

Seasonal swing summer↔winter36.7 °C

Max temp (day)14.4 °C 9.40–18.7

Min temp (night)6.50 °C 0.6–8.60

Precipitation88.0 mm/mo 52.3–134

Air humidity61.6 % 55.1–64.6

Moisture balance-9.00 mm/mo -44.8–23.6

Vapour deficit484 Pa 327–670

Wind speed3.00 m/s 2.00–4.50

Cloud cover44.2 % 37.1–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 143 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)