Arctosa leopardus

(Sundevall, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records9 311

Data sources9

Biological traits11

DNA specimens25

eDNA detections20

Sources9 archives

Databases and archives Arctosa leopardus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

World Spider Trait DBMasaryk University11 traits · 26 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements26 literature sources11 traits

Occurrence & distributionGBIF9 311 records

Environmental DNA1 datasets · 7 countries20 detections

DNA & barcodingBOLD25 specimens

01Narrative

Arctosa leopardus is a species of spiders belonging to the family Lycosidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 26 sources

Birkhofer et al. 2017Simonneau et al. 2016Entling et al. 2007Buchar & Růžička 2002Staręga et al. 2001SLU 2020Gajdoš et al. 2014Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Henriksen & Hilmo 2015Komposch & Steinberger 1999Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀9.25·♂6 mm

Predation2

Hunting guildground hunters

Simple hunting guild classificationcursorial

Ecology8

Ballooninghigh

Light0.875 mm

Light 2semi-open

Moisture 10.625 mm

Moisture 2humid

Regional IUCN Red List categoryLeast Concern (lc)

Regional non-IUCN Red List categoryNear Threatened (V)

Stratumvegetation

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa leopardus has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections20

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 103 variable positions, in barcode order

1Amostly conserved

7Gmostly conserved

16Avariable

22Gmostly conserved

28Gmostly conserved

31Tmostly conserved

37Amostly conserved

39Tmostly conserved

67Tmostly conserved

74Tmostly conserved

76Amostly conserved

79Amostly conserved

95Tmostly conserved

97Amostly conserved

100Gmostly conserved

110Tmostly conserved

112Amostly conserved

121Amostly conserved

122Amostly conserved

124Amostly conserved

130Gmostly conserved

145Tmostly conserved

148Gmostly conserved

151Tmostly conserved

157Tmostly conserved

166Amostly conserved

169Tmostly conserved

175Gmostly conserved

181Tmostly conserved

184Gmostly conserved

190Amostly conserved

196Gmostly conserved

199Gmostly conserved

202Tmostly conserved

205Tmostly conserved

208Gmostly conserved

211Gmostly conserved

217Tmostly conserved

232Tmostly conserved

241Amostly conserved

251Cmostly conserved

253Tmostly conserved

265Amostly conserved

271Tmostly conserved

274Amostly conserved

280Gmostly conserved

286Amostly conserved

289Gmostly conserved

295Gmostly conserved

307Amostly conserved

313Amostly conserved

316Amostly conserved

319Tmostly conserved

322Gmostly conserved

325Amostly conserved

328Amostly conserved

340Tmostly conserved

352Tmostly conserved

359Gmostly conserved

361Tmostly conserved

370Gvariable

376Tmostly conserved

379Tmostly conserved

382Amostly conserved

391Tmostly conserved

409Amostly conserved

412Tmostly conserved

421Tmostly conserved

433Gmostly conserved

436Gmostly conserved

439Gmostly conserved

445Tmostly conserved

472Gmostly conserved

475Gvariable

483Amostly conserved

484Amostly conserved

490Amostly conserved

497Cmostly conserved

499Cvariable

508Tmostly conserved

511Amostly conserved

517Amostly conserved

520Gmostly conserved

526Amostly conserved

529Tmostly conserved

535Amostly conserved

538Amostly conserved

541Gvariable

547Cmostly conserved

553Tmostly conserved

556Amostly conserved

562Tmostly conserved

565Amostly conserved

580Amostly conserved

583Gvariable

592Tmostly conserved

598Tmostly conserved

607Cmostly conserved

616Tmostly conserved

628Tmostly conserved

631Tmostly conserved

637Tmostly conserved

643Amostly conserved

AACTTTGTATTTAATATTTGGGGTTTGGTCTGCTATAGTAGGTACTGCAATAAGAGTATTAATTCGTATGGAATTAGGAAATTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes5

BIN1

Most divergent pair8.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa stigmosasame genus8.5%Dolomedes sulfureussame order9.9%Cupiennius chiapanensissame order10.0%Anoteropsis hilarissame family10.3%Lobizon ojangurenisame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 311 records

Wild obs. + sensor7 198

Museum / vouchered2 092

Cultivated / captive19

Other2

Origin

Native1 754

Range

Area of Occupancy AOO8 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 1 399≤1 km 360≤10 km 4 679>10 km 52

6 490 georeferenced · 708 without coordinates

Open the mapobservation + sensor7 198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 50≤1 km 38≤10 km 1 320>10 km 13

1 421 georeferenced · 671 without coordinates

Open the institutions mapphysical evidence2 092

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 19 records without

Open the mapnot free-living19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	327
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	227
Adam Mickiewicz University in Poznańlocation not on record	131
Helsinki, FI	38
Uniwersytet w Białymstokulocation not on record	32
Zoologisches Museum Hamburglocation not on record	20
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	16
Tartu, EE	11
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	11
Tilburg, NL	10
Bonn, DE	9
SLU Artdatabankenlocation not on record	8
Frankfurt am Main	7
Ekaterinburg, RU	7
Ghent, BE	6
Centre for Biodiversity Genomicslocation not on record	6
ARTlocation not on record	6
Bern, CH	5
SNSB-Zoologische Staatssammlung Münchenlocation not on record	4
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	4
Royal Museum for Central Africalocation not on record	3
	3
Bavarian State Collection of Zoologylocation not on record	3
ZSMlocation not on record	3
NTNU-VMlocation not on record	2
Akademia Pomorska w Słupskulocation not on record	2
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	2
Copenhagen, DK	2
Paro, BT	2
Finnish Museum of Natural History, Zoological Museumlocation not on record	1
SGAV-and-NHMDlocation not on record	1
Taurida National V.I.Vernadsky Universitylocation not on record	1
South Kensington, GB	1

33 institutions · 911 of 2 092 vouchered records shown · 1 180 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Arctosa leopardus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map7 countries0

FlusstalmoorDamp salt meadowUfergeroll, UEberschwemmungsebene, Wald unte…Wald, Moor, Heide

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C -0.8–16.8

Seasonal swing summer↔winter18.5 °C

Max temp (day)13.9 °C 3.20–19.4

Min temp (night)7.10 °C -5.10–12.7

Precipitation66.9 mm/mo 54.1–99.4

Air humidity62.4 % 57.6–64.4

Moisture balance11.3 mm/mo -63.8–69.7

Vapour deficit490 Pa 208–767

Wind speed4.00 m/s 2.50–5.60

Cloud cover45.4 % 36.5–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arctosa leopardus

At a glance

Sources9 archives

Morphometry1

Predation2

Ecology8

At a glance

Record type9 311 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 311 records