Anoteropsis hilaris

(L.Koch, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Anoteropsis

At a glance

Occurrence records343

Data sources8

Biological traits1

DNA specimens38

eDNA detections39

Sources8 archives

Databases and archives Anoteropsis hilaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility343 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF343 records

Environmental DNA1 datasets · 1 countries39 detections

DNA & barcodingBOLD38 specimens

01Narrative

Anoteropsis hilaris, commonly referred as the garden wolf spider or the grey wolf spider, is a species of wolf spider that is endemic to New Zealand. It is also known as the european wolf spider, because it lives in Southeastern Europe. Vink, C. (2002). Lycosidae (Arachnida: Araneae). Fauna of New Zealand 44: 1-94.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesVan Erp et al. 2002

Life History1

Mortality♀0.3·♂0.45 mm

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoteropsis hilaris has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes1

eDNA detections39

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

7Gmostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

13Amostly conserved

14Amostly conserved

15Tmostly conserved

16Amostly conserved

17Tmostly conserved

20Gmostly conserved

22Tmostly conserved

23Gmostly conserved

24Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

33Cmostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Tmostly conserved

42Gmostly conserved

43Amostly conserved

45Cmostly conserved

47Gmostly conserved

48Cmostly conserved

50Amostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Gmostly conserved

58Gmostly conserved

59Tmostly conserved

60Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Amostly conserved

72Amostly conserved

73Gvariable

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

80Cmostly conserved

81Amostly conserved

82Tmostly conserved

83Tmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Gmostly conserved

89Amostly conserved

90Gmostly conserved

91Tmostly conserved

199Gmostly conserved

370Amostly conserved

412Gmostly conserved

472Gmostly conserved

484Gmostly conserved

538Gmostly conserved

547Gmostly conserved

559Amostly conserved

562Amostly conserved

583Gmostly conserved

AACTTTGTATTTAATATTTGGTGTTTGATCTGCTATAGTTGGAACAGCTATAAGTGTGTTAATTCGAATAGAGTTAGGTCATTCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes7

BIN1

Most divergent pair1.7%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Artoriopsis expolitasame family7.5%Dolomedes sulfureussame order8.4%Diapontia anfibiasame family9.0%Dolomedes plantariussame order9.7%Lobizon ojangurenisame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type343 records

Wild obs. + sensor331

Museum / vouchered12

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 154≤1 km 75≤10 km 12>10 km 27

268 georeferenced · 63 without coordinates

Open the mapobservation + sensor331

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	5
Buenos Aires, AR	2

2 institutions · 7 of 12 vouchered records shown · 5 without an institution code

09Environmental DNA39 detections

Where the DNA of Anoteropsis hilaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map1 country0

Freshwater LakeForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 14.8–17.5

Seasonal swing summer↔winter9.80 °C

Max temp (day)18.5 °C 18.2–20.7

Min temp (night)12.9 °C 10.5–13.2

Precipitation103 mm/mo 90.1–118

Air humidity60.9 % 60.7–61.8

Moisture balance-28.0 mm/mo -41.4–52.6

Vapour deficit696 Pa 647–784

Wind speed4.50 m/s 3.80–4.60

Cloud cover36.0 % 35.8–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)