Dolomedes plantarius

(Clerck, 1757) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Pisauridae/Dolomedes

At a glance

Occurrence records2 182

Data sources11

Biological traits8

DNA specimens21

eDNA detections22

Sources11 archives

Databases and archives Dolomedes plantarius's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

World Spider Trait DBMasaryk University8 traits · 38 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements38 literature sources8 traits

Occurrence & distributionGBIF2 182 records

Environmental DNA2 datasets · 4 countries22 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · NCBI≈2.8 Gbp

01Narrative

The great raft spider or fen raft spider (Dolomedes plantarius) is a European species of spider in the family Pisauridae. Like other Dolomedes spiders, it is semiaquatic, hunting its prey on the surface of water. It occurs mainly in neutral to alkaline, unpolluted water of fens and grazing marsh.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 38 sources

IUCN 1996Order z1202-17Ur. l. RS 57/93Nature and Landscape Protection Act 2002D.g.r. 8/7736Ministerial Decree 2001Wildlife and Countryside Act 1981BartSchV 2005Law 1992LGBl 2015LGBl 2007Buchar & Růžička 2002Hyvärinen et al. 2019Henriksen & Hilmo 2015Golemansky et al. 2015Gajdoš et al. 2014Gajdoš & Svatoň 2001SLU 2020Bruun & Lissner 2019Spuris et al. 1998Liste France 2018Harvey et al. 2017Kielhorn 2017Groppali & Priano 1992Finch 2004ULRS 2002Sacher & Platen 2004Buchholz et al. 2011Martin 2012Zalevskiy & Bronskov 2017Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Komposch & Steinberger 1999Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀16.5·♂13 mm

Predation1

Hunting guildsheet web weavers

Ecology6

Global IUCN Red List categoryVulnerable (VU)

Legal protectionYes

Light 2open

Moisture 2very humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryCritically Endangered (1)

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dolomedes plantarius has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections22

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

22Gmostly conserved

25Amostly conserved

40Gmostly conserved

46Avariable

61Gmostly conserved

70Amostly conserved

79Gvariable

187Tmostly conserved

280Avariable

289Gvariable

325Gvariable

347Tmostly conserved

349Avariable

382Gvariable

613Tmostly conserved

614Gmostly conserved

615Amostly conserved

618Cmostly conserved

619Amostly conserved

620Gmostly conserved

621Cmostly conserved

623Gmostly conserved

AACTTTGTATTTTATATTTGGGGTATGATCTGCTATAGTGGGTACAGCTATAAGAGTGTTGATTCGAATAGAATTAGGGAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes6

BINs2

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolomedes fimbriatussame genus3.8%Dolomedes striatussame genus4.3%Dolomedes fontussame genus4.6%Dolomedes sulfureussame genus4.7%Dolomedes senilissame genus5.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Dolomedes plantarius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 780 156 309 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dolomedes plantarius2.78 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98% BUSCO

08Occurrence & distribution

Record type2 182 records

Wild obs. + sensor2 017

Museum / vouchered162

Other3

Origin

Native2

Range

Area of Occupancy AOO3 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 694≤1 km 330≤10 km 750>10 km 30

1 804 georeferenced · 213 without coordinates

Open the mapobservation + sensor2 017

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 3≤1 km 40≤10 km 33>10 km 9

85 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	33
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	19
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	18
Uniwersytet w Białymstokulocation not on record	8
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	8
Copenhagen, DK	7
Naturalis Biodiversity Centerlocation not on record	5
Ekaterinburg, RU	5
Brussels, BE	5
SLU Artdatabankenlocation not on record	4
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	4
Frankfurt am Main	3
MZLUlocation not on record	3
Tartu, EE	2
	2
Adam Mickiewicz University in Poznańlocation not on record	2
BioFokuslocation not on record	1
Chicago, US	1
Centre for Biodiversity Genomicslocation not on record	1
Tilburg, NL	1

20 institutions · 132 of 162 vouchered records shown · 30 without an institution code

09Environmental DNA22 detections

Where the DNA of Dolomedes plantarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys2

Countries4

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 6.80–18.6

Seasonal swing summer↔winter18.8 °C

Max temp (day)18.8 °C 9.60–23.1

Min temp (night)10.7 °C 3.20–14.6

Precipitation68.6 mm/mo 45.8–82.8

Air humidity60.1 % 57.9–67.7

Moisture balance-24.5 mm/mo -52.2–45.0

Vapour deficit669 Pa 320–904

Wind speed3.50 m/s 2.50–4.20

Cloud cover48.5 % 36.4–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dolomedes plantarius

At a glance

Sources11 archives

Morphometry1

Predation1

Ecology6

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 182 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 182 records