Arabidopsis thaliana
(L.) Heynh. · speciesAt a glance
Occurrence records259 451
Data sources13
Biological traits72
DNA specimens88
eDNA detections53
Sources13 archives
Databases and archives Arabidopsis thaliana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility259 451 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics88 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources72 traits
Chemical compositionLOTUS · NPASS1 080 compounds
Occurrence & distributionGBIF259 451 records
Environmental DNA2 datasets · 10 countries53 detections
DNA & barcodingBOLD · NCBI88 specimens
Genome at a glanceCCDB · GoaT · NCBI176 Mbp
01Narrative
L’Arabette des dames ou Arabette de Thalius est une espèce de plantes à fleurs appartenant à la famille des Brassicacées. Elle est souvent trouvée au bord des routes. Cette petite plante annuelle, originaire d'Europe, d'Asie et du nord-ouest de l'Afrique, a un cycle de vie rapide, elle est résistante et peut s'autoféconder. A. thaliana a un génome relativement petit d'environ 135 millions de paires de bases (Mbp). Ces qualités en ont fait depuis 1998 un organisme modèle de référence, pour la recherche aussi bien biologique que génétique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology26
Fruit length17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 12.5 mm
Fruit length max20 mm
Fruit length min5 mm
Fruit width0.85 mm
⚠ sources differ — AusTraits: 0.85 mm · GIFT: 1 mm
Fruit width max1 mm
Fruit width min0.5 mm
Leaf length27.5 mm
⚠ sources differ — AusTraits: 27.5 mm · GIFT: 10 mm
Leaf length max50 mm
Leaf length min5 mm
Leaf mass9.64 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 281 mm² · GIFT: 281 mm²
Leaf width7 mm
Leaf width max15 mm
Leaf width min1 mm
Plant height0.229 m
⚠ sources differ — GIFT: 0.229 m · AusTraits: 0.45 m · LEDA: 0.075 m · TRY: 0.184 m
Plant height generative0.25 m
Plant height max0.7 m
Plant height min0.01 m
Seed length0.485 mm
Seed length min0.5 mm
Seed mass0.021 mg
⚠ sources differ — TRY: 0.021 mg · LEDA: 0.02 mg · GIFT: 0.031 mg
Seed mass max0.1 mg
Seed mass min0.01 mg
Seed volume0.016 mm³
Seed volume max0.016 mm³
Seed volume min0.016 mm³
Life cycle & reproduction17
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourwhite
Flower length max3 mm
Flower length min2 mm
Flowering endJun
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number500
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 900 m
Elevation mean1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual
Habitat GIFTcrop fields, mountains, old fields, saline places, steppe, stony places
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeelliptical lanceolate spathulate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio27.73 g/g
Leaf c353 mg/g
Leaf dry-matter content (LDMC)128 mg/g
⚠ sources differ — TRY: 128 mg/g · LEDA: 104 mg/g
Leaf n42.8 mg/g
Leaf p4.9 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)31.53 mm²/mg
Other traits3
Diaspore typegenerative dispersule
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition1 080 compounds
Compounds documented for Arabidopsis thaliana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aminoacids60
Glucosinolates52
Flavonols43
Monosaccharides40
Purine alkaloids37
Documented compounds1 080 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (((5-(Methylsulfinyl)-1-(((2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yl)thio)pentylidene)amino)oxy)sulfonic acid | present | LOTUS | |
| ((5-(4-Amino-2-oxopyrimidin-1-yl)-3,4-dihydroxyoxolan-2-yl)methoxy-hydroxyphosphoryl) (2,3,4-trihydroxy-3-methylbutyl) hydrogen phosphate | present | LOTUS | |
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-Abscisic acid beta-D-glucopyranosyl ester | present | LOTUS | |
| (+)-alpha-Barbatene | present | LOTUS | |
| (+)-alpha-Bulgarene | present | LOTUS | |
| (+)-alpha-Carene | present | LOTUS | |
| (+)-Camphene | present | LOTUS | |
| (+)-gamma-Bulgarene | present | LOTUS | |
| (+)-gamma-Tocopherol | present | LOTUS |
05DNA & barcoding88 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arabidopsis thaliana has left across the world's sequence archives.
At a glance
DNA specimens88
Marker genes11
GenBank sequences10
eDNA detections53
Countries11
The DNA barcodea real sequence read deposited for this species
TCTCACTACCTGGTGTTCTGCCTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGATTCTG …
Arabidopsis thaliana voucher Khon Kaen ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK5★rbcL4★rbcLa★trnL★ITS1★ITS1★ITS2atp6COIICOXIII
animal barcodeplant barcodefungal barcodemitochondrial
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_037304 ↗ · 33 protein · 22 tRNA · 3 rRNA
nad5cox2ccmBrps3rpl16nad9atp6nad1atp1rps7nad2cox1rps4nad6cobrpl5ccmFCnad4mttBrpl2matRnad7atp8atp9nad3rps12+9
◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Arabidopsis thaliana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size176 040 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
THIS GENOME Arabidopsis thaliana0.18 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidy2× diploid · measured
Chromosome records6–102n range10median10mode104records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 10101×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Kolník M., 2007: [New records in Arabidopsis], pp. 102. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2273
CCDB · fl-europaea — Bocher & Larsen,
CCDB · ipcn-api-dl — Kirschner, J., J. Stepanek & J. Stepankova. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 574–575.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Chiba, Y. & S. Goto. 1983. Study of life cycle in Arabidopsis thaliana (L.) Heynh. Live Teaching Mater. Inf. Serv. Mar. 46–48. (In Japanese).
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Maluszynska, J. & J. S. Heslop-Harrison. 1993. Molecular cytogenetics of the genus Arabidopsis: in situ localization of rDNA sites, chromosome numbers and diversity in centromeric heterochromatin. Ann. Bot. (London) 71: 479–484.
CCDB · ipcn-api-dl — Murata, M. & F. Motoyushi. 1995. Floral chromosomes of Arabidopsis thaliana for detecting low-copy DNA sequences by fluorescence in situ hybridization. Chromosoma 104: 39–43.
CCDB · ipcn-api-dl — Ančev, M. E. & V. Goranova. 1997. Mediterranean chromosome number reports 7 (855--872). Fl. Medit. 7: 246–258.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Koch, M., J. Bishop & T. Mitchell-Olds. 1999. Molecular systematics and evolution of Arabidopsis and Arabis. Pl. Biol. (Stuttgart) 1: 529–537.
CCDB · ipcn-api-dl — Ito, M., N. Ohmido, Y. Akiyama & K. Fukui. 2000. Quantitative chromosome map of Arabidopsis thaliana L. by imaging methods. Cytologia 65: 325–331.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Jonsell, B. 1976. Some tropical African Cruciferae. Chromosome numbers and taxonomic comments. Bot. Not. 129: 123–130.
CCDB · ipcn-api-dl — Maassoumi, A. A. R. 1980. Cruciferes de la flore d'lran. Etude Caryosystematique. Thesis, Strasbourg, 1980. 1–83.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Runemark, H. 2000. Mediterranean chromosome number reports 10 (1110--1188). Fl. Medit. 10: 386–402.
CCDB · ipcn-api-dl — Osman, K. 2006. Chromosome synapsis in Arabidopsis: analysis of the transverse filament protein ZYP1 reveals novel functions for the synaptonemal complex. Chromosoma 115: 212–219.
CCDB · ipcn-api-dl — Johnston. 2005. Evolution of genome size in Brassicaceae. Ann. Bot. (Oxford) 95: 229–235.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. Chromosome numbers of flowering plants in the Netherlands v. Proc. Kon. Ned. Acad. Wetensch. ser C 74:
CCDB · book-ipcn67-71 — MESICEK, J. 1967. The chromosome morphology of Arabidopsis thaliana (L.) Heynh. and some remarks on the problem of Hylandra suecica (Fr.) Loeve. Fol. Geobot. & Phytotaxon. 2: 433-436.
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-northern-plants — Jaretzky 1932.
CCDB · book-ipcn73-74 — LEUTE, G.-H. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
CCDB · book-indian_vol1 — Winge, b. 1925 ; Jaretzky, R. 1928a; Manton, I. 1932; Hedberg, O. 1957; Bocher, T .W.-& Larsen, K. 1958b ; Stei- nitz-Sears, L.M. 1962, 1963; Sorsa, V. 1963b; Mulligan, G.A 1964; Poljakova, T. (Fedorov); Mesicek, J. 1967; .Gadel- la, T.W.J. & Kliphuis, E. 1971a, 1972; Leute, G.-H. 1974; Jonsell, B. 1976: Hedberg, I. & Hedberg, O. 1977
CCDB · eflora
CCDB · book-fedorov — Hara H. 1952
CCDB · book-fedorov — Winge 1925
CCDB · book-fedorov — Jaretzky 1928a
CCDB · book-fedorov — Manton 1932
CCDB · book-fedorov — Hedberg O. 1957
CCDB · book-fedorov — Booher, Laz en 1958b
CCDB · book-fedorov — Steinitz-Sears 19ti2. 1963 hir
+51 more references
2n 63×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · CromoCat 2015
CCDB · book-indian_vol1 — Titova, N.N. (Fedorov)
CCDB · book-fedorov — THTOBa 1935
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 521×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +3
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 748-763. Ruz de Clavijo Jimnez, E.Lagascalia17(2): 379-388(1994).
CCDB · book-ipcn65 — Raj 1965
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Lan, Y. z. & T. y. Cheo. 1989. Cytotaxonomical studies on Chinese species of Cruciferae. P. 283 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · brass — Mulligan
CCDB · brass — Lan & Cheo
CCDB · brass — Winge
CCDB · brass — Sorsa
CCDB · brass — Tischler
CCDB · brass — Raj
CCDB · brass — Laibach
CCDB · brass — Jaretzky
CCDB · brass — Steinitz-Sears
CCDB · brass — Murata et al.
CCDB · brass — Ruz de Clavijo
CCDB · Cave1963 — Steinitz-Sears 1962, 1963; Sorsa 1963c
CCDB · CromoCat 2015 — Lan,Y.-z. & Cheo, T.-y. (1989). Cytotaxonomical studies on Chinese species of Cruciferae. In D. Hong (editor), Plant Chromosome Research 1987. P. 283.
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1994). Números cromosómicos para la flora española. 748-763. Lagascalia 17(2): 379-388.
CCDB · CromoCat 2015 — Sorsa, V. (1963b). Chromosomenzahlen Finnischer Kormophyten, II. Ann. Acad. Sci. Fenn., Sér. A 68: 1-14.
n 61×CCDB · brass
CCDB · brass — Titova
n 71×CCDB · brass
CCDB · brass — Maassoumi
n 81×CCDB · book-ipcn65
CCDB · book-ipcn65 — Arnold & Cruse 1965
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
Completeness99.3% BUSCO
08Occurrence & distribution
Record type259 451 records
Wild obs. + sensor241 725
Museum / vouchered16 018
Cultivated / captive985
Other723
Origin
Native19 117
Introduced49
Range
Area of Occupancy AOO374 408 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy37% within 1 km
≤100 m 38 921≤1 km 40 060≤10 km 132 762>10 km 1 180
212 923 georeferenced · 28 802 without coordinates
Open the mapobservation + sensor241 725
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 1 129≤1 km 2 997≤10 km 3 550>10 km 1 053
8 729 georeferenced · 7 289 without coordinates
Open the institutions mapphysical evidence16 018
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 15
17 georeferenced · 968 without coordinates
Open the mapnot free-living985
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions211 of 374 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 212 |
| Olocation not on record | 1 292 |
| GBR140location not on record | 1 036 |
| Helsinki, FI | 744 |
| LDlocation not on record | 507 |
| Berlin, DE | 501 |
| BIO-UNIPIlocation not on record | 408 |
| Moscow State Universitylocation not on record | 343 |
| Trondheim, NO | 338 |
| Paris, FR | 333 |
| South Kensington, GB | 305 |
| MeiseBGlocation not on record | 259 |
| BFLlocation not on record | 256 |
| Philadelphia, US | 249 |
| Bergen, NO | 206 |
| KMNlocation not on record | 204 |
| Turku, FI | 194 |
| Oskarshamn, SE | 167 |
| Kuopio, FI | 161 |
| Saint Louis, US | 154 |
| BClocation not on record | 138 |
| Chongqing Museumlocation not on record | 133 |
| Oulu, FI | 133 |
| SLU Artdatabankenlocation not on record | 132 |
| MAlocation not on record | 129 |
| Uppsala, SE | 113 |
| BRNUlocation not on record | 111 |
| Bronx, US | 110 |
| Salzburg, AT | 102 |
| Tartu, EE | 101 |
| València, ES | 96 |
| Provincia di Livornolocation not on record | 90 |
| Adam Mickiewicz University in Poznańlocation not on record | 78 |
| WTUlocation not on record | 77 |
| Chapel Hill, US | 77 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 73 |
| Entomological Society of Latvialocation not on record | 71 |
| TUR-Alocation not on record | 68 |
| Barcelona, ES | 67 |
| BDBClocation not on record | 66 |
| College Park, US | 64 |
| Bloomington, US | 63 |
| University of Stellenboschlocation not on record | 62 |
| Christchurch, NZ | 60 |
| TROMlocation not on record | 56 |
| Nagano City, JP | 54 |
| Uniwersytet Warszawskilocation not on record | 51 |
| Corvallis, US | 51 |
| Williamsburg, US | 51 |
| Zürich, CH | 49 |
| GMBAlocation not on record | 47 |
| Lausanne, CH | 47 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 46 |
| Vitoria, ES | 45 |
| Nanjing, CN | 44 |
| CICYTEXlocation not on record | 43 |
| Zürich, CH | 42 |
| Badajoz, ES | 39 |
| Toyama, JP | 35 |
| Allentown, US | 34 |
| Wlocation not on record | 33 |
| Ann Arbor, US | 33 |
| College of the Atlantic, Museumlocation not on record | 33 |
| Bangkok, TH | 32 |
| Wuzhou, CN | 31 |
| Odawara, JP | 31 |
| GJOlocation not on record | 30 |
| Columbia, US | 29 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 28 |
| Hobart, AU | 28 |
| Pullman, US | 28 |
| Stockholm, SE | 27 |
| Moscow, US | 27 |
| Victoria, CA | 26 |
| Auckland, NZ | 26 |
| Beijing, CN | 26 |
| Bern, CH | 26 |
| Jyväskylä, FI | 25 |
| Jaén, ES | 25 |
| Salamanca, ES | 25 |
| Burlington, US | 24 |
| New Haven, US | 24 |
| Riverside, US | 24 |
| Tallinn, EE | 23 |
| Mlocation not on record | 22 |
| San Sebastián, ES | 22 |
| Tsukuba, JP | 21 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 20 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 20 |
| Natural History Museum Rotterdamlocation not on record | 20 |
| Portland, US | 20 |
| Canadian Department of Agriculturelocation not on record | 18 |
| DBF-NHMDlocation not on record | 18 |
| DAOlocation not on record | 18 |
| Knoxville, US | 17 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 17 |
| Uniwersytet Jagiellońskilocation not on record | 17 |
| KIRMlocation not on record | 17 |
| Canberra, AU | 17 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 17 |
| KOMlocation not on record | 17 |
| Sanda, JP | 17 |
| Norfolk, US | 16 |
| Missoula, US | 16 |
| Shinshu Universitylocation not on record | 16 |
| Arcata, US | 16 |
| PRClocation not on record | 16 |
| Madrid, ES | 16 |
| Claremont, US | 15 |
| JP | 15 |
| Görlitz, DE | 15 |
| ISAlocation not on record | 15 |
| Kew, GB | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| Wellington, NZ | 14 |
| Pamplona, ES | 14 |
| Millersville, US | 14 |
| Madison, US | 13 |
| Porvoo, FI | 13 |
| Québec, CA | 12 |
| PrivatHerblocation not on record | 12 |
| Tuscaloosa, US | 11 |
| Staten Island, US | 11 |
| Mount Annan, AU | 10 |
| nbflocation not on record | 10 |
| Granada, ES | 10 |
| GZUlocation not on record | 10 |
| Wuhan, CN | 10 |
| Fukushima Universitylocation not on record | 10 |
| Washington, US | 10 |
| Museo Achille Folettolocation not on record | 9 |
| Davis, US | 9 |
| Tilburg, NL | 9 |
| Bourges, FR | 9 |
| Boise, US | 9 |
| Cheney, US | 9 |
| Dekalb, US | 9 |
| Zhejiang Universitylocation not on record | 9 |
| Vancouver, CA | 9 |
| Santiago de Compostela, ES | 9 |
| SZUlocation not on record | 9 |
| Guangzhou, CN | 9 |
| Dresden, DE | 9 |
| Provo, US | 8 |
| Otaru, JP | 8 |
| CJBGlocation not on record | 8 |
| Université Lavallocation not on record | 8 |
| Little Rock, US | 8 |
| Yangling, CN | 8 |
| McWane Science Centerlocation not on record | 8 |
| Clemson, US | 8 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 7 |
| Chiba, JP | 7 |
| Frauenfeld, CH | 7 |
| Tampa, US | 7 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 7 |
| San Diego, US | 7 |
| Rotorua, NZ | 7 |
| Brisbane, AU | 7 |
| Dover, US | 7 |
| Flagstaff, US | 7 |
| Sagamihara, JP | 7 |
| EL PASO, US | 7 |
| Mississippi State, US | 6 |
| Alicante, ES | 6 |
| Herb. BBGlocation not on record | 6 |
| Tomioka, JP | 6 |
| Gijón, ES | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Weber State Universitylocation not on record | 6 |
| Porrentruy, CH | 6 |
| Museo Entomologico de Leonlocation not on record | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Forssa, FI | 6 |
| Akita Prefectural Museumlocation not on record | 6 |
| SIHUlocation not on record | 6 |
| H-Schuhwlocation not on record | 5 |
| Kunming, CN | 5 |
| Austin, US | 5 |
| Seoul, KR | 5 |
| Osaka, JP | 5 |
| Tacoma, US | 5 |
| GAlocation not on record | 5 |
| Pretoria, ZA | 5 |
| Ashland, US | 5 |
| Awka, NG | 5 |
| Kushiro City Museumlocation not on record | 5 |
| Fayetteville, US | 5 |
| Phyletisches Museum Jenalocation not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| Philadelphia, US | 5 |
| Denver, US | 4 |
| Northridge, US | 4 |
| UGentlocation not on record | 4 |
| UIBlocation not on record | 4 |
| Namur, BE | 4 |
| NBSIlocation not on record | 4 |
| New Brunswick, US | 4 |
| University of New Hampshirelocation not on record | 4 |
| Santa Barbara, US | 4 |
| BGBMlocation not on record | 4 |
| Logan, US | 4 |
| Kawasaki Shi Tama Ku, JP | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Sendai, JP | 4 |
| Philadelphia, US | 4 |
| AUAlocation not on record | 4 |
| Sevilla, ES | 4 |
| Denton, US | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Jackson, US | 4 |
| Fairfax, US | 4 |
| Acadia Universitylocation not on record | 4 |
| Rishon Le Zion, IL | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| Toyota city nature sanctuarylocation not on record | 4 |
| Toronto, CA | 4 |
| BSBIlocation not on record | 4 |
| San Luis Obispo, US | 4 |
| Xiamen, CN | 4 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 4 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| TAIElocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Bozeman, US | 3 |
| KURAlocation not on record | 3 |
| QAUlocation not on record | 3 |
| St. Paul, US | 3 |
| Spearfish, US | 3 |
| Urumqi, CN | 3 |
| KR | 3 |
| Córdoba, ES | 3 |
| Santa Cruz, US | 3 |
| LfUlocation not on record | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| Pamplona, ES | 3 |
| CASlocation not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| Dhaka, BD | 3 |
| H-AkrKGlocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Whitehorse, CA | 3 |
| Fort Worth, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| No collectionlocation not on record | 2 |
| Henderson, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Podgorica, ME | 2 |
| Wuhan, CN | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Xining, CN | 2 |
| IDElocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Göteborg, SE | 2 |
| Chadron, US | 2 |
| ESP003location not on record | 2 |
| Angwin, US | 2 |
| BAYLUlocation not on record | 2 |
| Phoenix, US | 2 |
| San Angelo, US | 2 |
| Green Bay, US | 2 |
| UoB-IBlocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Pocatello, US | 2 |
| Hangzhou, CN | 2 |
| QVMAGlocation not on record | 2 |
| Jiujiang Forestry Institutelocation not on record | 2 |
| Rovaniemi, FI | 2 |
| Sant Julià de Lòria, AD | 2 |
| North Carolina Museum of Natural Scienceslocation not on record | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Durham, US | 2 |
| Morgantown, US | 2 |
| Kensington, AU | 2 |
| Chengdu, CN | 2 |
| Changsha, CN | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Cape Town, ZA | 2 |
| San Francisco, US | 2 |
| Nijmegen, NL | 2 |
| Taipei, TW | 2 |
| Hokkaido University Museumlocation not on record | 1 |
| Conway, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Los Angeles, US | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Edmonton, CA | 1 |
| Caldwell, US | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Arequipa, PE | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Zhengzhou, CN | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Guiyang, CN | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Montréal, CA | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Brussel, BE | 1 |
| Johnson City, US | 1 |
| Orem, US | 1 |
| Asheville, US | 1 |
| Hudson, US | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Coimbra, PT | 1 |
| TAFORI-LSRClocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Bothell, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| US | 1 |
| LINUlocation not on record | 1 |
| Sion, CH | 1 |
| TADlocation not on record | 1 |
| JBSlocation not on record | 1 |
| Mexico City, MX | 1 |
| US | 1 |
| Pittsburg, US | 1 |
| H-Hohlalocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Castelar, AR | 1 |
| US | 1 |
| Nishihara, JP | 1 |
| Cambridge, US | 1 |
| Whitewater, US | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Winterthur, CH | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Tokushima, JP | 1 |
| Lanzhou, CN | 1 |
| Shenzhen, CN | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| STNFlocation not on record | 1 |
| Honolulu, US | 1 |
| SWlocation not on record | 1 |
| Sapporo, JP | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| GB | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Chengdu, CN | 1 |
| Universidad Católica de Santa Maríalocation not on record | 1 |
| San Isidro, AR | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| WNNUlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Bend, US | 1 |
| Lincoln, US | 1 |
| Edinburgh, GB | 1 |
| Baltimore, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| UMKClocation not on record | 1 |
374 institutions · 14 965 of 16 018 vouchered records shown · 903 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA53 detections
Where the DNA of Arabidopsis thaliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found53
Studies independent surveys2
Countries10
Verifiable raw sequence linked2
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 53 detections have coordinates
Open the map10 countries0
Screes
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.2 °C 5.30–16.9
Seasonal swing summer↔winter14.9 °C
Max temp (day)14.1 °C 8.60–20.7
Min temp (night)5.80 °C 1.90–13.6
Precipitation72.0 mm/mo 41.7–123
Air humidity60.6 % 56.4–63.6
Moisture balance-18.2 mm/mo -57.7–57.3
Vapour deficit527 Pa 359–782
Wind speed3.40 m/s 2.40–5.40
Cloud cover43.6 % 38.7–55.7
CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.