Trifolium pratense
speciesAt a glance
Occurrence records1 282 793
Data sources19
Biological traits153
DNA specimens171
eDNA detections881
Sources19 archives
Databases and archives Trifolium pratense's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 282 793 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI881 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics171 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources153 traits
Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS4 552 compounds
Occurrence & distributionGBIF1 282 793 records
Environmental DNA4 datasets · 19 countries881 detections
DNA & barcodingBOLD · NCBI171 specimens
Genome at a glanceCCDB · GIFT · GoaT469 Mbp
01Narrative
Trifolium pratense, the red clover, is a herbaceous species of flowering plant in the bean family Fabaceae, native to Europe, Western Asia, and northwest Africa, but planted and naturalized in many other regions.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology26
Fruit length3 mm
Fruit width3 mm
Leaf length40 mm
Leaf length max225 mm
Leaf length min15 mm
Leaf mass37.36 mg
Leaf size408 mm²
⚠ sources differ — TRY: 408 mm² · LEDA: 716 mm² · GIFT: 716 mm²
Leaf width12.5 mm
⚠ sources differ — AusTraits: 12.5 mm · GIFT: 26 mm
Leaf width max30 mm
Leaf width min7 mm
Plant height0.464 m
⚠ sources differ — GIFT: 0.464 m · AusTraits: 0.6 m · LEDA: 0.275 m · USDA: 0.61 m · TRY: 0.26 m
Plant height generative0.291 m
Plant height max1 m
Plant height min0.05 m
Seed length1.9 mm
⚠ sources differ — TRY: 1.9 mm · AusTraits: 1.5 mm · GIFT: 2 mm
Seed length max2 mm
Seed length min1.5 mm
Seed mass1.47 mg
Seed mass max2.37 mg
Seed mass min0.59 mg
Seed volume2 mm³
Seed volume max2 mm³
Seed volume min2 mm³
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction40
After harvest regrowth rateModerate
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourpurple
⚠ sources differ — GIFT: violet · USDA: Red
Flower conspicuousYes
Flower length max18 mm
Flower length min15 mm
Flowering endOct
Flowering startMay
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formperennial
Life spanperennial
Lifespan categoryShort
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityfire_killed
Seed number50.55
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment34
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatHigh
Climatetemperate
Climberself-supporting
Elevation max3 300 m
Elevation mean2 200 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typelegume
Growth formherb
Growth form USDASingle Crown
Habitat GIFTcrop fields
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf formelliptic
Leaf retentionNo
Leaf shapeelliptical obovate orbicular
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min120 days
Leaf C:N ratio12.72 g/g
Leaf c464 mg/g
Leaf dry-matter content (LDMC)264 mg/g
⚠ sources differ — TRY: 264 mg/g · LEDA: 225 mg/g
Leaf n37.77 mg/g
Leaf p2.1 mg/g
Moisture useMedium
Nitrogen fixation levelMedium
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min35 in
Protein potentialHigh
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max7.6 pH
Soil pH min6 pH
Specific leaf area (SLA)23.39 mm²/mg
Temperature min-28 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound272 160 per lb
ToxicityNone
Veneer productNo
Other traits8
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Monocarpymonocarp
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition4 552 compounds
Compounds documented for Trifolium pratense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Glycerophospholipids57
Isoflavones55
Unsaturated fatty acids24
Pterocarpan22
Triacylglycerols17
Documented compounds4 552 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| WATER | 823,000 ppm | DukesPhytochem | |
| CARBOHYDRATES | 763,000 ppm | DukesPhytochem | |
| PROTEIN | 380,000 ppm | DukesPhytochem | |
| FIBER(DIETARY) | 360,000 ppm | DukesPhytochem | |
| FIBER | 301,000 ppm | DukesPhytochem | |
| SUGARS | 120,000 ppm | DukesPhytochem | |
| FIBER(CRUDE) | 99,000 ppm | DukesPhytochem |
05DNA & barcoding171 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium pratense has left across the world's sequence archives.
At a glance
DNA specimens171
Marker genes10
GenBank sequences10
eDNA detections881
Countries19
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGAAGCCTCTTG …
Trifolium pratense subsp. pratense voucher PLT.0017 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL4★rbcLa★trnL-F★ITS5★ITS1★ITS2cp-trnL-introntrnH-psbA
animal barcodeplant barcodefungal barcodemarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_048499 ↗ · 32 protein · 17 tRNA · 3 rRNA
nad1nad2atp1nad3rps12nad5mttBnad4Latp4rps10cox1ccmFcatp9rpl16rps3ccmBnad4matRatp6ccmFn2ccmFn1ccmCrps4nad9atp8cox3+9
◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Trifolium pratense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size469 440 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium pratense0.47 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–562n range14median14mode152records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 14126×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +18
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.
CCDB · ita-fl — LOON J.C., JONG H. - 1978. IOPB chromosome number reports LIX.. Taxon , 27(1): 57-60.
CCDB · ita-fl — CODIGNOLA A., MAFFEI M. - 1983 (1981). Numeri cromosomici per la flora italiana:846-849.. Inform. Bot. Ital. , 13(2-3): 179-181.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Bernátová D., 2007: [New records in Betonica, Buphtalmum, Dianthus, Pilosella, Polygonatum, Prenanthes, Ranunculus, Silene, Solidago, Tragopogon, Trifolium, and Tussilago], pp. 125, 135, 225, 440, 461, 468, 488, 497, 547, 554, 588, 592, 596. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Leskovjanská A., 2007: [New records in Cirsium, Eupatorium, Lapsana, Leontodon, Medicago, Melilotus, Plantago, Salvia, Senecio, Silene, Sonchus, Tanacetum, Thlaspi, Trifolium, and Veronica], pp. 195, 251, 355, 359, 384, 387, 453, 518, 536, 549, 555, 568, 582, 592, 603. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VI Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Lagascalia2(1): 3-13(1972).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2972
CCDB · fl-europaea — Reese, 1952
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Kapoor, B. M. & S. Ramcharitar. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 596–597.
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — Yefimov, K. F. 1987. Chromosome numbers in some members of the Fabaceae from central Caucasus. Bot. Zhurn. 72: 845.
CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Semerenko, L. V. & I. V. Shvets. 1989. Karyologicheskoe isuchenie bobovykh (Fabaceae) Belorussii. Pp. 66--68 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Reddy, V. R. K. 1989. Karyomorphological studies in Indigofera and Trifolium. J. Cytol. Genet. 24: 30–35.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · ipcn-api-dl — Hill, L. M. 1995. IOPB chromosome data 10. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 25: 8–9.
CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Zhao, D. l., R. j. Wang, H. y. Liu & X. j. Hu. 2000. Karyotype analysis of Trifolium pratense. J. Dalian Univ. 21(2): 86–87, 90.
CCDB · ipcn-api-dl — Zhao, D. l., Z. Hu, W. Chen, X. w. Jiang & L. s. Wang. 2001. Karyotype analysis of Sphallerocarpus gracilis and Trifolium pratense from China. Acta Bot. Boreal.-Occid. Sin. 21(5): 1026–1027.
CCDB · ipcn-api-dl — LOON VAN, J. C. & H. D. JONG. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — TOMKINS, D. J. & W. F. Grant. 1978. Morphological and genetic factors influencing the response of weed species to herbicides. Canad. J. Bot. 56: 1466–1471.
CCDB · ipcn-api-dl — Vachova, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
+81 more references
2n 1616×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · iber-fl — Trifolium baeticum Boiss. y Trifolium pallidum Waldst & Kit. Valds, B. & F. Gonzlez Bernldez.Lagascalia2(2): 189(1972).
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Karshibaev, H. K. 1992. Chromosome numbers of some Fabaceae in the Uzbekistan. Pp. 26–27 <in> Tezisy III Soveshchanie po Kariologii Rastenii.
CCDB · ipcn-api-dl — Zhang, Z. p., L. h. Wu & Y. f. Kang. 1993. Analyses of karyotypes in six forage grass species of Leguminosae. Bot. Res 1: 60–61.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Yang, M. j., D. k. Yang & L. x. Fu. 2003. Chromosome studies on two species of Trifolium L. Shandong Sci. 16(4): 17–20.
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · CromoCat 2015 — Karshibaev, H. K. (1992). Chromosome numbers of some Fabaceae in the Uzbekistan Pp. 26–27 Tezisy III Soveshchanie po Kariologii Rastenii.
CCDB · CromoCat 2015 — Krasnikov, A. A. & Schaulo, D. N. (1990). Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II Botani?eskij Žurnal (Moscow & Leningrad) 75: 118-120
CCDB · CromoCat 2015 — Krogulevich, R. E. (1976b). Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Ac. Sci. USSR, ser. Biol. 15(3): 46-52 (In Russian)
CCDB · CromoCat 2015 — Krogulevich, R. E. (1978a). Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19-48. Nauka, Novosibirsk.
CCDB · CromoCat 2015 — Yang, M. j., D. k. Yang & L. x. Fu (2003). hromosome studies on two species of Trifolium L. Shandong Sci. 16(4): 17–20
CCDB · CromoCat 2015 — Zhang, Z. -P., L. -H. Wu & Y. -F Kang (1993a). Analyses of karyotypes in six forage grass species of Leguminosae. Bot. Res. N. China 1:60-61
2n 286×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Büyükkartal, H. N. 2003. In vitro pollen germination and pollen tube characteristics in tetraploid red clover (Trifolium pratense L.). Türk Biyol. Derg. 27(1): 57–61.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-indian_vol1 — Povilaitis, B. & Boyes, J.W. 1956; Zhukova, P.G. 1967b
CCDB · CromoCat 2015 — Büyükkartal, H. N. (2003). In vitro pollen germination and pollen tube characteristics in tetraploid red clover (Trifolium pratense L.). Türk Biyol. Derg. 27(1): 57–61
CCDB · CromoCat 2015 — Povilaitis, B. & J. W. Boyes. (1956). A cytological study of autotetraploid red clover. Amer. J. Bot. 43: 169-174.
GIFT · GIFT (floras)
2n 482×CCDB · book-ipcn73-74 · GIFT · GIFT (floras)
CCDB · book-ipcn73-74 — SCHWER, J.F., & R.W. CLEVELAND. 1972. Tetraploid and triploid interspecific hybrids of Trifolium pratense L., ! diffusum Ehrh., and some related species. Crop Sci. (Madison) 12: 419 422.
GIFT · GIFT (floras)
2n 562×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 77×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · Cave1956 — Povilaitie& Boyes
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1300-1301
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
n 142×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Povilaitis, B. & J. W. Boyes. (1956). A cytological study of autotetraploid red clover. Amer. J. Bot. 43: 169-174.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness93% BUSCO
07Deep time~6.58 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin6.58 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type1 282 793 records
Wild obs. + sensor1 248 108
Museum / vouchered28 644
Cultivated / captive816
Other5 225
Origin
Native47 674
Introduced859
Range
Area of Occupancy AOO1 110 280 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 270 899≤1 km 225 911≤10 km 515 275>10 km 10 826
1 022 911 georeferenced · 225 197 without coordinates
Open the mapobservation + sensor1 248 108
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 2 347≤1 km 5 500≤10 km 9 681>10 km 1 182
18 710 georeferenced · 9 934 without coordinates
Open the institutions mapphysical evidence28 644
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤1 km 4≤10 km 37>10 km 46
87 georeferenced · 729 without coordinates
Open the mapnot free-living816
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions289 of 547 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 8 418 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 341 |
| Helsinki, FI | 702 |
| Moscow State Universitylocation not on record | 633 |
| BFLlocation not on record | 621 |
| South Kensington, GB | 500 |
| LDlocation not on record | 453 |
| Salzburg, AT | 426 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 404 |
| Philadelphia, US | 375 |
| Olocation not on record | 360 |
| HUN003location not on record | 289 |
| Madison, US | 288 |
| Berlin, DE | 251 |
| Chongqing Museumlocation not on record | 249 |
| Wuzhou, CN | 220 |
| Uniwersytet Warszawskilocation not on record | 211 |
| Oskarshamn, SE | 196 |
| St. Paul, US | 191 |
| Bergen, NO | 176 |
| Bronx, US | 175 |
| MeiseBGlocation not on record | 169 |
| Odawara, JP | 160 |
| TROMlocation not on record | 157 |
| Jyväskylä, FI | 155 |
| Oulu, FI | 147 |
| NLD037location not on record | 147 |
| Trondheim, NO | 138 |
| Nagano City, JP | 126 |
| GBR016location not on record | 125 |
| MAlocation not on record | 124 |
| BDBClocation not on record | 122 |
| Chiba, JP | 119 |
| Museo Entomologico de Leonlocation not on record | 118 |
| Beijing, CN | 114 |
| Shinshu Universitylocation not on record | 105 |
| SLU Artdatabankenlocation not on record | 105 |
| Kuopio, FI | 102 |
| Bangkok, TH | 100 |
| València, ES | 99 |
| WTUlocation not on record | 90 |
| Turku, FI | 90 |
| KMNlocation not on record | 89 |
| Bloomington, US | 87 |
| Québec, CA | 86 |
| Wlocation not on record | 85 |
| Albuquerque, US | 83 |
| Christchurch, NZ | 83 |
| Chadron, US | 83 |
| Uniwersytet Opolskilocation not on record | 78 |
| College Park, US | 78 |
| Barcelona, ES | 77 |
| Saint Louis, US | 77 |
| Ann Arbor, US | 75 |
| BClocation not on record | 75 |
| Saint John, CA | 72 |
| Pullman, US | 71 |
| Denver, US | 71 |
| CICYTEXlocation not on record | 70 |
| Badajoz, ES | 70 |
| Acadia Universitylocation not on record | 70 |
| Mount Annan, AU | 68 |
| BGR001location not on record | 64 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 63 |
| Entomological Society of Latvialocation not on record | 62 |
| Görlitz, DE | 61 |
| Spearfish, US | 60 |
| Université Lavallocation not on record | 60 |
| Montréal, CA | 59 |
| Zürich, CH | 59 |
| University of New Hampshirelocation not on record | 58 |
| TUR-Alocation not on record | 58 |
| Vitoria, ES | 57 |
| Kew, GB | 56 |
| Fukushima Universitylocation not on record | 56 |
| Tartu, EE | 53 |
| KURAlocation not on record | 53 |
| Burlington, US | 53 |
| Williamsburg, US | 52 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 52 |
| Bando, JP | 52 |
| Karlsruhe, DE | 51 |
| Wuhan, CN | 50 |
| ROM007location not on record | 49 |
| Corvallis, US | 49 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 49 |
| Canberra, AU | 49 |
| Moscow, US | 49 |
| Emporia, US | 48 |
| BRNUlocation not on record | 48 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 48 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 47 |
| Millersville, US | 46 |
| Yangling, CN | 45 |
| University of Stellenboschlocation not on record | 44 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 44 |
| Green Bay, US | 43 |
| New Haven, US | 43 |
| Zürich, CH | 42 |
| Hobart, AU | 41 |
| Auckland, NZ | 41 |
| Tallinn, EE | 39 |
| Toyama, JP | 39 |
| Riverside, US | 37 |
| Salamanca, ES | 36 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 35 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 34 |
| Wellington, NZ | 34 |
| Iwate Prefectural Museumlocation not on record | 33 |
| Mlocation not on record | 32 |
| Missoula, US | 32 |
| Tula State Universitylocation not on record | 32 |
| UniKSlocation not on record | 31 |
| Pamplona, ES | 31 |
| Pittsburg, US | 31 |
| Uppsala, SE | 31 |
| Garðabær, IS | 30 |
| NSMKlocation not on record | 30 |
| Tsukuba, JP | 30 |
| Porvoo, FI | 29 |
| Flagstaff, US | 29 |
| Brisbane, AU | 29 |
| Adelaide, AU | 29 |
| Arcata, US | 29 |
| Toronto, CA | 29 |
| Provincia di Livornolocation not on record | 28 |
| Kawasaki Shi Tama Ku, JP | 28 |
| Boise, US | 28 |
| Kochi, JP | 27 |
| GMBAlocation not on record | 27 |
| Urumqi, CN | 27 |
| Armidale, AU | 27 |
| Allentown, US | 27 |
| Madrid, ES | 26 |
| Tomioka, JP | 26 |
| San Sebastián, ES | 26 |
| Bern, CH | 26 |
| Davis, US | 26 |
| Frankfurt am Main | 25 |
| MKD001location not on record | 25 |
| University of Alberta Museumslocation not on record | 25 |
| Otaru, JP | 25 |
| ROM003location not on record | 24 |
| Norfolk, US | 24 |
| New Brunswick, US | 24 |
| Sanda, JP | 23 |
| Knoxville, US | 22 |
| Whitewater, US | 22 |
| Hiratsuka City Museumlocation not on record | 22 |
| Seoul, KR | 22 |
| WINlocation not on record | 22 |
| ASUlocation not on record | 22 |
| Guangzhou, CN | 21 |
| Dekalb, US | 21 |
| Canadian Department of Agriculturelocation not on record | 21 |
| Universidad Católica de Santa Maríalocation not on record | 21 |
| McWane Science Centerlocation not on record | 21 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 21 |
| SVK001location not on record | 21 |
| Lord Fairfax Community Collegelocation not on record | 21 |
| YUG027location not on record | 21 |
| Jackson, US | 21 |
| Kushiro City Museumlocation not on record | 20 |
| Portland, US | 20 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 20 |
| Zhengzhou, CN | 20 |
| SVN019location not on record | 20 |
| Santa Barbara, US | 20 |
| Porto Alegre, BR | 20 |
| College of the Atlantic, Museumlocation not on record | 19 |
| JP | 19 |
| Taipei, TW | 19 |
| Adam Mickiewicz University in Poznańlocation not on record | 19 |
| Fayetteville, US | 18 |
| Mississippi State, US | 18 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 18 |
| Phyletisches Museum Jenalocation not on record | 18 |
| Sagamihara, JP | 18 |
| IDElocation not on record | 17 |
| Bozeman, US | 17 |
| Rovaniemi, FI | 17 |
| Chapel Hill, US | 17 |
| Angwin, US | 17 |
| Vancouver, CA | 17 |
| Staten Island, US | 16 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 16 |
| Pamplona, ES | 16 |
| Victoria, CA | 16 |
| Voronezh State Universitylocation not on record | 16 |
| Dover, US | 16 |
| Logan, US | 16 |
| Kandalaksha State Nature Reservelocation not on record | 16 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 15 |
| San Diego, US | 15 |
| UGentlocation not on record | 15 |
| Chongqing, CN | 15 |
| Nagatoro-machi, Chichibu-gun, JP | 15 |
| Dresden, DE | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| GB | 14 |
| Philadelphia, US | 14 |
| BAYLUlocation not on record | 14 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| Granada, ES | 14 |
| Nanjing, CN | 13 |
| Tuscaloosa, US | 13 |
| Edinburgh, GB | 13 |
| Santiago de Compostela, ES | 13 |
| Pocatello, US | 12 |
| Columbia, US | 12 |
| Fort Worth, US | 12 |
| Provo, US | 12 |
| University of Guelph, OAC Herbariumlocation not on record | 12 |
| Fredericksburg, US | 12 |
| KOMlocation not on record | 12 |
| Hudson, US | 12 |
| Durham, US | 11 |
| ESP119location not on record | 11 |
| POL003location not on record | 11 |
| Waverly, US | 11 |
| GJOlocation not on record | 11 |
| 11 | |
| EL PASO, US | 11 |
| Johnson City, US | 11 |
| Museo Regionale di Scienze Naturali Efisio Noussan, Regione Autonoma Valle d'Aostalocation not on record | 11 |
| AZE015location not on record | 11 |
| Xining, CN | 11 |
| Alicante, ES | 11 |
| University of Tennessee at Chattanoogalocation not on record | 11 |
| Wuhan, CN | 11 |
| Morgantown, US | 10 |
| Córdoba, ES | 10 |
| Rotorua, NZ | 10 |
| Turlock, US | 10 |
| GZUlocation not on record | 10 |
| Grand Junction, US | 10 |
| Chengdu, CN | 10 |
| USFS/BHSClocation not on record | 10 |
| US | 10 |
| Porrentruy, CH | 10 |
| Universidad de La Salle (La Salle)location not on record | 10 |
| CZE096location not on record | 10 |
| Chicago, US | 9 |
| Universidad Nacional de Colombia (UNAL)location not on record | 9 |
| Kirksville, US | 9 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 9 |
| San Isidro, AR | 9 |
| Universidad de Caldas (UCaldas)location not on record | 9 |
| Keene State Universitylocation not on record | 9 |
| *unvoucheredlocation not on record | 9 |
| Kensington, AU | 9 |
| Tampa, US | 9 |
| Parthenon Tama History Museumlocation not on record | 9 |
| Kunming, CN | 9 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 9 |
| ESP103location not on record | 9 |
| National Institute of Biological Resourceslocation not on record | 9 |
| KR | 9 |
| Jaén, ES | 9 |
| Davenport, US | 8 |
| Washington, US | 8 |
| Sendai, JP | 8 |
| Winterthur, CH | 8 |
| KIWElocation not on record | 8 |
| Taipei, TW | 8 |
| Coimbra, PT | 8 |
| China Agricultural Universitylocation not on record | 8 |
| Tilburg, NL | 8 |
| Tokushima, JP | 8 |
| J.F.Oberlin Universitylocation not on record | 8 |
| Minia, EG | 8 |
| Anchorage, US | 8 |
| Caldwell, US | 7 |
| San Luis Obispo, US | 7 |
| Chicago, US | 7 |
| BSBIlocation not on record | 7 |
| Lincoln, US | 7 |
| Springfield, US | 7 |
| PUC-RSlocation not on record | 7 |
| OLAlocation not on record | 7 |
| Mexico City, MX | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Osaka, JP | 7 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 7 |
| Claremont, US | 7 |
| Chengdu, CN | 7 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| Little Rock, US | 7 |
| Korea National Arboretumlocation not on record | 7 |
| KIRMlocation not on record | 6 |
| Fairfax, US | 6 |
| Phoenix, US | 6 |
| Xinxiang, CN | 6 |
| Northridge, US | 6 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 6 |
| DBF-NHMDlocation not on record | 6 |
| GAlocation not on record | 6 |
| Guilin, CN | 6 |
| San Angelo, US | 6 |
| Parkville, AU | 6 |
| Museum of the Rockieslocation not on record | 6 |
| SZUlocation not on record | 6 |
| Los Angeles, US | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Paris, FR | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Tacoma, US | 5 |
| Pomona Collegelocation not on record | 5 |
| Philadelphia, US | 5 |
| CASlocation not on record | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Rocky Mountain Biological Laboratorylocation not on record | 5 |
| Forssa, FI | 5 |
| Whitehorse, CA | 5 |
| Sant Julià de Lòria, AD | 5 |
| WNNUlocation not on record | 5 |
| UTPLlocation not on record | 5 |
| AUAlocation not on record | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 5 |
| Jefferson City, US | 5 |
| Nishihara, JP | 5 |
| Richmond, US | 5 |
| Austin, US | 4 |
| Batemans Bay, AU | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| Omachi Alpine Museumlocation not on record | 4 |
| ISAlocation not on record | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Bourges, FR | 4 |
| Nijmegen, NL | 4 |
| University of Lethbridgelocation not on record | 4 |
| University of Genevalocation not on record | 4 |
| Herb. BBGlocation not on record | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| University of British Columbia, Herbariumlocation not on record | 4 |
| Beijing Normal Universitylocation not on record | 4 |
| ROM023location not on record | 4 |
| Xiamen, CN | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Cheney, US | 4 |
| Blumenau, BR | 4 |
| Durango, US | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Altos de Pipe, VE | 4 |
| Truckee, US | 4 |
| UChlocation not on record | 4 |
| Sevilla, ES | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Edmonton, CA | 4 |
| Loja, EC | 4 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Santa Cruz, US | 3 |
| Durango, MX | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Ivano-Frankove, UA | 3 |
| Smithsonian Institutionlocation not on record | 3 |
| Brookings, US | 3 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 3 |
| US | 3 |
| Palmerston, AU | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Guiyang, CN | 3 |
| Chicago, US | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| Changsha, CN | 3 |
| Frauenfeld, CH | 3 |
| Tennessee Technological Universitylocation not on record | 3 |
| Dehra Dun, IN | 3 |
| Ashland, US | 3 |
| Wollongong, AU | 3 |
| nbflocation not on record | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 3 |
| AUT060location not on record | 3 |
| Glarus, CH | 3 |
| US | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Musée des Confluenceslocation not on record | 3 |
| US | 3 |
| Ypsilanti, US | 3 |
| QVMAGlocation not on record | 3 |
| Lubbock, US | 3 |
| Göteborg, SE | 3 |
| Mohonk Preservelocation not on record | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| LfUlocation not on record | 3 |
| Campo Mourão, BR | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Banyoles, ES | 3 |
| Urumqi, CN | 3 |
| Ishikawa Museum of Natural Historylocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Jishou Universitylocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| EEZA-CSIClocation not on record | 2 |
| JBRJlocation not on record | 2 |
| PRClocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 2 |
| UNESClocation not on record | 2 |
| HJAEFlocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| DMZ botanic gardenlocation not on record | 2 |
| FUVATESlocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| Long Beach, US | 2 |
| Hamilton, US | 2 |
| Palmerston North, NZ | 2 |
| Bend, US | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Bothell, US | 2 |
| Asheville, US | 2 |
| Orem, US | 2 |
| Clemson, US | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Lanzhou, CN | 2 |
| Criciúma, BR | 2 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 2 |
| SIHUlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| UIBlocation not on record | 2 |
| KNFHClocation not on record | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| LPMMBHlocation not on record | 2 |
| Tempe, US | 2 |
| Taipei, TW | 2 |
| JBSlocation not on record | 2 |
| QCNElocation not on record | 2 |
| SWlocation not on record | 2 |
| Macomb, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| KNAMlocation not on record | 2 |
| Kingston, US | 2 |
| Royal Botanic Gardens, Kewlocation not on record | 2 |
| Valparaíso, CL | 2 |
| Guatemala City, GT | 2 |
| Gijón, ES | 2 |
| Mount Pleasant, US | 2 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 2 |
| Conway, US | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Yukon Universitylocation not on record | 2 |
| Beijing, CN | 2 |
| Mexico City, MX | 2 |
| Trois-Rivières, CA | 2 |
| Weber State Universitylocation not on record | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| Nanjing, CN | 2 |
| Shanghai, CN | 2 |
| Guiyang, CN | 2 |
| Central China Agricultural Universitylocation not on record | 2 |
| San Francisco, US | 2 |
| Guiyang, CN | 2 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Ciudad de México, MX | 2 |
| San Jose, US | 2 |
| Monastir, TN | 1 |
| UFPRlocation not on record | 1 |
| Russellville, US | 1 |
| arosemena tola, EC | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| PHlocation not on record | 1 |
| Jiangxi Universitylocation not on record | 1 |
| Lake Charles, US | 1 |
| NEAUlocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| UMKClocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Chengdu, CN | 1 |
| UoB-IBlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Brussel, BE | 1 |
| Pretoria, ZA | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| TAIElocation not on record | 1 |
| Berea Collegelocation not on record | 1 |
| Boumlocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Universität Basel, Herbariumlocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| KNFYlocation not on record | 1 |
| Ischia Marine Centrelocation not on record | 1 |
| Cincinnati, US | 1 |
| BioFokuslocation not on record | 1 |
| Heilongjiang Academy of Scienceslocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Sapporo, JP | 1 |
| CPPSULlocation not on record | 1 |
| Aarhus, DK | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| ESP003location not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Stockholm, SE | 1 |
| Decorah, US | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Portland, US | 1 |
| Henderson, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Oswego, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| AUT001location not on record | 1 |
| Montréal, CA | 1 |
| Sion, CH | 1 |
| Walla Walla, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Smithfield, AU | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Salvador, BR | 1 |
| Podgorica, ME | 1 |
| Brasília, BR | 1 |
| NMBU:MINAlocation not on record | 1 |
| Hangzhou, CN | 1 |
| USP-IBlocation not on record | 1 |
| Torreón, MX | 1 |
| Montecillo, Texcoco, MX | 1 |
| Elikins, US | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| xMDC-Clintonlocation not on record | 1 |
547 institutions · 26 466 of 28 644 vouchered records shown · 1 466 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA881 detections
Where the DNA of Trifolium pratense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found881
Studies independent surveys4
Countries19
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 881 detections have coordinates
Open the map19 countries0
Palearctic2049Dry, open hillside with Artemisia tridentata…meadowPhenology=FLnursery greenhouse
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.2 °C 6.10–17.2
Seasonal swing summer↔winter22.6 °C
Max temp (day)14.6 °C 8.60–21.1
Min temp (night)8.20 °C 3.80–13.8
Precipitation78.3 mm/mo 62.8–95.3
Air humidity63.7 % 58.8–67.6
Moisture balance37.4 mm/mo -44.5–44.6
Vapour deficit482 Pa 306–759
Wind speed4.20 m/s 2.20–4.40
Cloud cover51.8 % 39.6–59.7
CHELSA 1981–2010, ~9 km grid, at location & month of 847 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.