Callitriche palustris
speciesAt a glance
Occurrence records30 166
Data sources14
Biological traits133
DNA specimens29
eDNA detections13
Sources14 archives
Databases and archives Callitriche palustris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility30 113 records↗
OBISOcean Biodiversity Information System53 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics29 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources133 traits
Occurrence & distributionGBIF · OBIS30 166 records
Environmental DNA1 datasets · 5 countries13 detections
DNA & barcodingBOLD · NCBI29 specimens
Genome at a glanceCCDB · GoaT1.9 Gbp
01Narrative
Callitriche palustris est une espèce de plantes herbacées aquatique de la famille des Callitrichaceae selon la classification classique de Cronquist (1981) ou de la famille des Plantaginaceae selon la classification phylogénétique APG III (2009).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology22
Fruit length1.25 mm
Fruit length max1.5 mm
Fruit length min1 mm
Leaf length9 mm
Leaf length max12 mm
Leaf length min6 mm
Leaf mass0.595 mg
Leaf size58.12 mm²
Leaf width3.5 mm
Leaf width max5 mm
Leaf width min2 mm
Plant height0.2 m
⚠ sources differ — GIFT: 0.2 m · AusTraits: 0.1 m · LEDA: 0.009 m · USDA: 0.244 m · TRY: 0.05 m
Plant height generative0.1 m
Plant height max0.5 m
Plant height min0.03 m
Seed length1 mm
Seed mass0.079 mg
⚠ sources differ — TRY: 0.079 mg · AusTraits: 0.069 mg · LEDA: 0.076 mg · GIFT: 0.203 mg
Seed mass max0.08 mg
Seed mass min0.076 mg
Seed volume0.065 mm³
Seed volume max0.065 mm³
Seed volume min0.065 mm³
Life cycle & reproduction35
Bloom periodSpring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: epizoochor
Flower colourgreen
Flower conspicuousNo
Flowering endOct
Flowering startApr
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formhydroannual
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual · LEDA: perennials · GIFT: annual
Lifespan categoryShort
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number148 290
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationabsent
Sex typemonoecious
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticaquatic
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 600 m
Elevation mean2 250 m
Elevation min700 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourgreen
Fruit fleshinessdry
Fruit typenut
Growth formherb
Growth form USDASingle Crown
Habitat GIFTaquatic
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min8 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceHigh
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementMedium
Fire resistantYes
Fire toleranceHigh
Frost free days min90 days
Leaf dry-matter content (LDMC)111 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min32 in
Salinity toleranceNone
Seed longevity index0.5
Shade toleranceHigh
Soil pH max6.8 pH
Soil pH min5.2 pH
Specific leaf area (SLA)73.53 mm²/mg
⚠ sources differ — TRY: 73.53 mm²/mg · LEDA: 106 mm²/mg · GIFT: 106 mm²/mg
Temperature min-33 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 000 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typefruit
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min2 700 per acre
05DNA & barcoding29 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitriche palustris has left across the world's sequence archives.
At a glance
DNA specimens29
Marker genes7
GenBank sequences10
eDNA detections13
Countries6
The DNA barcodea real sequence read deposited for this species
CTTATTTGGGCACCGAGATTTGCCGGACAAGACGCTCGCGTCGACCGCAAGTCAACGTCCCGCTCCCGAGAGATGCTTGCGTTGATCGGG …
Callitriche palustris isolate 316 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL4★rbcLa★ITS6★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Callitriche palustris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 907 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Callitriche palustris1.91 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy4× tetraploid · measured
Chromosome records10–402n range20median20mode51records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2045×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · iber-fl +15
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · iber-fl — Nmeros cromosomticos de algunas especies acuticas de Ranunculus L. y Callitriche en Asturias. Fernndez Bernaldo de Quirs, C.Rev. Biol.5: 65-70(1987).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3544
CCDB · fl-europaea — LOve & LOve, 1956
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · book-ipcn65 — Love & Love 1965c
CCDB · ipcn-api-dl — Fernández Bernaldo de Quirós, C. 1987. Números cromosomáticos de algunas especies acuáticas de Ranunculus L. y Callitriche en Asturias. Revista Biol. Univ. Oviedo 5: 65–70.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & S. A. Shatalova. 2001. Chromosome numbers in some plant species from the environs of Vladivostok city (Primorsky Region). Bot. Žhurn. (Moscow & Leningrad) 86(1): 168–172.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. IOPB chromosome number reports LXXVII. Taxon 31: 766–768.
CCDB · ipcn-api-dl — Milek, J. A. & G. A. Pratt. 1968. Cytological studies of three species in the genus Callitriche. J. Colorado-Wyoming Acad. Sci. 6(1): 52.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Philbrick, C. T. 1994. Chromosome counts for Callitriche (Callitrichaceae) in North America. Rhodora 96: 383–386.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1975. Chromosome numbers of some Western Chukolka plant species. Bot. Žhurn. (Moscow & Leningrad) 60(3): 395–401.
CCDB · book-ipcn66 — Love & Ritchie 1966
CCDB · book-ipcn67-71 — SCHOTSMAN, H. D. 1967. Les Callitriches. Especes de France et taxa nouveau d'Europe. Flore de France, Vol. 1: 1-152.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Chromosome numbers in some species of plants of the north-eastern part of the USSR. II. (In Russian). Bot. Zhur. 52: 983-987.
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-northern-plants — Jorgensen 1923, Sokolovskaja 1932.
CCDB · book-indian_vol1 — JBrgensen, C.A. 1923 ; Sokolovskaya, A.P. (Fedorov) ; Tischler,. G. 1934; L6ve, A. & LBve, D. 1956b ; Jor- gensen, C.A, et al. 1958 ; Savidge, J.P. 1960a ; Love, A. & Love, D. 1965b; L6ve, A. & Ritchie, J.C. 1966 ; Skalinska, M. et al. 1971
CCDB · book-fedorov — Coxoxoncxaa 1960a
CCDB · book-fedorov — Schotsman 1954, 1958, 1961a
CCDB · book-fedorov — Jorgensen 1923
CCDB · book-fedorov — CoKoHoncxaa 1932, 1963
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — LOve A., LOve D. 1956b
CCDB · book-fedorov — Jorgensen et al. 1958
CCDB · book-fedorov — Savidge 1960a
CCDB · book-fedorov — Love A., LOve D.
CCDB · book-fedorov — C. n. IV. 1965)
CCDB · book-fedorov — LOve A., Ritchie 1966
CCDB · book-atlas-flowering-plants — Sokolovskaja 1932
CCDB · kew — Pijnacker LP, Schotsman HD. 1988. Nuclear DNA amounts in European Callitriche species (Callitrichaceae). Acta Botanica Neerlandica 37: 129-135.
CCDB · Cave1956supp — Sohotsman 1954
CCDB · Cave1963 — Sokolovskaya 1963
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
+5 more references
2n 162×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Winge,(). 1917b
CCDB · book-fedorov — Winge 1917b
2n 382×CCDB · book-fedorov · CCDB · Cave1956supp
CCDB · book-fedorov — Jones H. 1955
CCDB · Cave1956supp — Jones 1955
2n 101×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Villani (2004). The genus Callitriche in northeastern Italy: first systematic contribution Israel J. Pl. Sci. 52: 331–340.
2n 401×CCDB · book-fedorov
CCDB · book-fedorov — Beuzenberg, Hair 1963
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type30 166 records
Wild obs. + sensor22 803
Museum / vouchered7 216
Cultivated / captive10
Other137
Origin
Native15
Introduced14
Range
Area of Occupancy AOO78 036 km²
Depth
0–200 m sunlit20
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 0.4 m · max 3.9 m · 20 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy64% within 1 km
≤100 m 5 689≤1 km 7 520≤10 km 6 529>10 km 831
20 569 georeferenced · 2 234 without coordinates
Open the mapobservation + sensor22 803
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 838≤1 km 1 361≤10 km 1 830>10 km 174
4 203 georeferenced · 3 013 without coordinates
Open the institutions mapphysical evidence7 216
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 9 without coordinates
Open the mapnot free-living10
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions160 of 275 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 034 |
| Olocation not on record | 479 |
| Moscow State Universitylocation not on record | 372 |
| Institute of the biological problems of the North FEB RASlocation not on record | 242 |
| LDlocation not on record | 217 |
| Oulu, FI | 210 |
| Salzburg, AT | 173 |
| St. Paul, US | 158 |
| SLU Artdatabankenlocation not on record | 156 |
| TROMlocation not on record | 149 |
| Metsähallituslocation not on record | 131 |
| Madison, US | 110 |
| Québec, CA | 109 |
| Tartu, EE | 99 |
| Wlocation not on record | 92 |
| Oskarshamn, SE | 92 |
| BRNUlocation not on record | 86 |
| Trondheim, NO | 84 |
| Garðabær, IS | 84 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 84 |
| Acadia Universitylocation not on record | 80 |
| PRClocation not on record | 79 |
| Turku, FI | 73 |
| Université Lavallocation not on record | 66 |
| Odawara, JP | 61 |
| Uppsala, SE | 57 |
| Görlitz, DE | 57 |
| Chongqing Museumlocation not on record | 56 |
| Burlington, US | 53 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 50 |
| BIO-UNIPIlocation not on record | 48 |
| BFLlocation not on record | 47 |
| Ann Arbor, US | 46 |
| Missoula, US | 45 |
| Saint John, CA | 45 |
| Museo Entomologico de Leonlocation not on record | 45 |
| Provincia di Livornolocation not on record | 44 |
| CJBGlocation not on record | 42 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 40 |
| Montréal, CA | 40 |
| MeiseBGlocation not on record | 37 |
| Kuopio, FI | 36 |
| Jyväskylä, FI | 32 |
| Green Bay, US | 32 |
| 31 | |
| GMBAlocation not on record | 31 |
| Flagstaff, US | 30 |
| GJOlocation not on record | 29 |
| Corvallis, US | 29 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 29 |
| TUR-Alocation not on record | 29 |
| Bergen, NO | 28 |
| WTUlocation not on record | 28 |
| Kochi, JP | 27 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 26 |
| Denver, US | 26 |
| Vancouver, CA | 26 |
| Tsukuba, JP | 26 |
| DULlocation not on record | 25 |
| Victoria, CA | 25 |
| Bando, JP | 25 |
| Bronx, US | 24 |
| Zürich, CH | 24 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 23 |
| University of Alberta Museumslocation not on record | 23 |
| New Haven, US | 22 |
| Barcelona, ES | 22 |
| Bern, CH | 21 |
| Toyama, JP | 21 |
| Mlocation not on record | 21 |
| Wuzhou, CN | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| San Diego, US | 19 |
| DBF-NHMDlocation not on record | 19 |
| BDBClocation not on record | 19 |
| KMNlocation not on record | 18 |
| CASlocation not on record | 18 |
| Phoenix, US | 18 |
| Nagano City, JP | 18 |
| Zürich, CH | 18 |
| Philadelphia, US | 17 |
| Clocation not on record | 16 |
| Entomological Society of Latvialocation not on record | 15 |
| UGentlocation not on record | 15 |
| Tokushima, JP | 15 |
| Albuquerque, US | 14 |
| Henderson, US | 14 |
| Helsinki, FI | 14 |
| Moscow, US | 13 |
| Forssa, FI | 13 |
| Tomioka, JP | 12 |
| Nijmegen, NL | 12 |
| Shinshu Universitylocation not on record | 12 |
| Whitehorse, CA | 12 |
| Beijing, CN | 12 |
| Frankfurt am Main | 12 |
| Caldwell, US | 12 |
| Anchorage, US | 11 |
| GZUlocation not on record | 10 |
| Voronezh State Universitylocation not on record | 10 |
| Bangkok, TH | 10 |
| Bozeman, US | 10 |
| Sanda, JP | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Toronto, CA | 9 |
| Osaka, JP | 9 |
| Uniwersytet Warszawskilocation not on record | 9 |
| Pullman, US | 8 |
| Saint Louis, US | 8 |
| MAlocation not on record | 8 |
| Porvoo, FI | 8 |
| Kushiro City Museumlocation not on record | 7 |
| Kunming, CN | 7 |
| Durham, US | 7 |
| Rocky Mountain Biological Laboratorylocation not on record | 7 |
| Claremont, US | 7 |
| College Park, US | 7 |
| Pocatello, US | 7 |
| Kagoshima, JP | 6 |
| Glarus, CH | 6 |
| nbflocation not on record | 6 |
| Bloomington, US | 6 |
| Durango, US | 6 |
| Chadron, US | 6 |
| Philadelphia, US | 6 |
| Boise, US | 6 |
| Riverside, US | 6 |
| CICYTEXlocation not on record | 6 |
| Stockholm, SE | 6 |
| Paris, FR | 5 |
| València, ES | 5 |
| KURAlocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Spearfish, US | 5 |
| Lincoln, US | 5 |
| Sion, CH | 5 |
| Umeå Universitylocation not on record | 5 |
| Logan, US | 5 |
| Davis, US | 5 |
| University of New Hampshirelocation not on record | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Sendai, JP | 4 |
| Tacoma, US | 4 |
| San Sebastián, ES | 4 |
| Fukushima Universitylocation not on record | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| US | 4 |
| Dekalb, US | 4 |
| Arcata, US | 4 |
| San Jose, US | 4 |
| South Kensington, GB | 4 |
| Porrentruy, CH | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| KIRMlocation not on record | 4 |
| Guangzhou, CN | 4 |
| Portland, US | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Keene State Universitylocation not on record | 4 |
| Provo, US | 4 |
| Tromso University Museumlocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Tallinn, EE | 3 |
| University of Wisconsinlocation not on record | 3 |
| Millersville, US | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| ASUlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| Bourges, FR | 3 |
| Sagamihara, JP | 3 |
| San Luis Obispo, US | 3 |
| Nanjing, CN | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Berlin, DE | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Hobart, AU | 3 |
| Kyoto Universitylocation not on record | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| EL PASO, US | 2 |
| Namur, BE | 2 |
| Tampere, FI | 2 |
| BClocation not on record | 2 |
| Dresden, DE | 2 |
| Williamsburg, US | 2 |
| Taipei, TW | 2 |
| USFS/BHSClocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Mount Annan, AU | 2 |
| Taipei, TW | 2 |
| Lausanne, CH | 2 |
| SZUlocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| San Francisco, US | 2 |
| Xining, CN | 2 |
| H-Adlerlocation not on record | 2 |
| Adelaide, AU | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Otaru, JP | 2 |
| Gijón, ES | 2 |
| Smithfield, AU | 2 |
| Fredericksburg, US | 2 |
| Fulda, DE | 2 |
| Alicante, ES | 2 |
| Guilin, CN | 2 |
| Chicago, US | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Canberra, AU | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Winterthur, CH | 1 |
| Xiamen, CN | 1 |
| US | 1 |
| WINlocation not on record | 1 |
| Jaén, ES | 1 |
| GINRlocation not on record | 1 |
| US | 1 |
| Elocation not on record | 1 |
| Hangzhou, CN | 1 |
| LfUlocation not on record | 1 |
| KR | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Salamanca, ES | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Baroda, IN | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Shanghai, CN | 1 |
| NoColllocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Nishihara, JP | 1 |
| AUAlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Tuscaloosa, US | 1 |
| ifplocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Orem, US | 1 |
| Sapporo, JP | 1 |
| Fullerton, US | 1 |
| SEFlocation not on record | 1 |
| Kew, GB | 1 |
| Montréal, CA | 1 |
| Pittsburg, US | 1 |
| Los Angeles, US | 1 |
| Fribourg, CH | 1 |
| Elikins, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Philadelphia, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Ashland, US | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Brussel, BE | 1 |
| Columbia, US | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| Copenhagen, DK | 1 |
| Boumlocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Madrid, ES | 1 |
| Edinburgh, GB | 1 |
275 institutions · 7 026 of 7 216 vouchered records shown · 188 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Callitriche palustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 7.80–15.8
Seasonal swing summer↔winter23.9 °C
Max temp (day)16.1 °C 11.6–19.9
Min temp (night)7.80 °C 3.00–11.7
Precipitation96.0 mm/mo 43.9–116
Air humidity62.2 % 56.0–66.6
Moisture balance12.2 mm/mo -45.6–85.7
Vapour deficit544 Pa 420–707
Wind speed3.00 m/s 1.50–3.80
Cloud cover51.6 % 36.7–64.1
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.