Cassytha filiformis
speciesAt a glance
Occurrence records12 984
Data sources13
Biological traits43
DNA specimens23
eDNA detections15
Sources13 archives
Databases and archives Cassytha filiformis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 979 records↗
OBISOcean Biodiversity Information System5 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics23 specimens↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources43 traits
Chemical compositionLOTUS · NPASS69 compounds
Occurrence & distributionGBIF · OBIS12 984 records
Environmental DNA1 datasets · 4 countries15 detections
DNA & barcodingBOLD23 specimens
Genome at a glanceCCDB · GIFT2n = 48
01Narrative
Cassytha filiformis est une espèce de plantes à fleurs la famille des Lauraceae. Ses noms vernaculaires sont Liane Foutafout, fausse cuscute et liane jaune. C'est une plante parasite à répartition pantropicale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFT
Size & morphology16
Fruit length5.6 mm
Fruit width4.75 mm
Inflorescence length max5 cm
Inflorescence length min2 cm
Leaf length1.65 mm
Leaf length max1 mm
Leaf size5 mm²
Plant height6.5 m
Plant height max10 m
Plant height min0 m
Seed mass39.37 mg
⚠ sources differ — TRY: 39.37 mg · AusTraits: 34.96 mg · GIFT: 43.65 mg
Seed mass max52.92 mg
Seed mass min34.38 mg
Seed volume13 mm³
Seed volume max13 mm³
Seed volume min13 mm³
Life cycle & reproduction9
Deciduousnessevergreen
Dispersal typeanimal
⚠ sources differ — AusTraits: zoochory · GIFT: hydrochorous
Flowering timeyyyyyyyyyyyy
Life formholoparasitic chamaephyte
Life spanperennial
Pollination syndromeinsect
Raunkiær life formphanerophyte
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteobligatory
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberobligatory
Elevation max1 600 m
Elevation mean1 290 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typedrupe
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous
Habitat GIFTbeach forest
Leaf compoundnesssimple
Leaf shapeovate
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition69 compounds
Compounds documented for Cassytha filiformis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aporphine alkaloids $ Isoquinoline alkaloids35
Flavonols12
Isoquinoline alkaloids $ Morphinan alkaloids6
Aporphine alkaloids4
Furofuranoid lignans3
Documented compounds69 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Diasyringaresinol | present | LOTUS | |
| (+)-Dicentrine | present | LOTUS | |
| (+)-Syringaresinol | present | LOTUS | |
| (+)-Yangambin | present | LOTUS | |
| (12R)-17-methoxy-5,7,19,21-tetraoxa-13-azahexacyclo[10.10.1.02,10.04,8.016,23.018,22]tricosa-1(22),2,4(8),9,16(23),17-hexaene | present | LOTUS | |
| (12S)-17-methoxy-5,7,19,21-tetraoxa-13-azahexacyclo[10.10.1.02,10.04,8.016,23.018,22]tricosa-1(22),2,4(8),9,16(23),17-hexaene | present | LOTUS | |
| (12S)-7,17-dimethoxy-3,5-dioxa-11-azapentacyclo[10.7.1.0^{2,6.0^{8,20.0^{14,19]icosa-1,6,8(20),14,16,18-hexaen-16-ol | present | LOTUS | |
| (6aS)-1,9,10-trimethoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-2-ol | present | LOTUS | |
| 1,2-Methylenedioxy-3,10,11-trimethoxyaporphine | present | LOTUS | |
| 17-Methoxy-5,7,19,21-tetraoxa-13-azahexacyclo[10.10.1.02,10.04,8.016,23.018,22]tricosa-1(22),2,4(8),9,16(23),17-hexaene | present | LOTUS |
05DNA & barcoding23 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassytha filiformis has left across the world's sequence archives.
At a glance
DNA specimens23
Marker genes6
eDNA detections15
Countries4
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P623 bp consensus4 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.
Diversity (π)1.4%
Haplotypes2
BINs0
Most divergent pair0.16%
Where individuals differ — all 17 variable positions, in barcode order
53Gmostly conserved
93Cmostly conserved
94Cmostly conserved
173Amostly conserved
182Gmostly conserved
196Cmostly conserved
224Amostly conserved
275Cmostly conserved
326Amostly conserved
355Cmostly conserved
365Amostly conserved
412Cmostly conserved
431Amostly conserved
452Cmostly conserved
472Cmostly conserved
499Cmostly conserved
527Cvariable
CAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACG …
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa★ITS★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Cassytha filiformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Chromosome records24–482n range48median48mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 483×CCDB · ipcn-api-dl · CCDB · eflora · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Okada, H. & R. TANAKA. 1975. Karyological studies in some species of Lauraceae. Taxon 24: 271–280.
CCDB · eflora
GIFT · GIFT (floras)
2n 241×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 243×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Davidse, G. 1981. Chromosome numbers of miscellaneous angiosperms. Ann. Missouri Bot. Gard. 68: 222–223.
CCDB · ipcn-api-dl — Carr, G. D. 1978. Chromosome numbrs of Hawaiian flowering plants and the significance of cytology in selected taxa. Amer. J. Bot. 65: 236–242.
CCDB · book-ipcn75-78 — Carr 1978
n 121×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sobha, V. I. K. R. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 269.
08Occurrence & distribution
Record type12 984 records
Wild obs. + sensor5 776
Museum / vouchered6 662
Other546
Origin
Native812
Range
Area of Occupancy AOO29 708 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 2 948≤1 km 412≤10 km 208>10 km 231
3 799 georeferenced · 1 977 without coordinates
Open the mapobservation + sensor5 776
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 555≤1 km 228≤10 km 699>10 km 135
1 617 georeferenced · 5 045 without coordinates
Open the institutions mapphysical evidence6 662
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions137 of 312 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 406 |
| Saint Louis, US | 337 |
| Bronx, US | 318 |
| Tsukuba, JP | 252 |
| Palmerston, AU | 198 |
| Pretoria, ZA | 186 |
| Kew, GB | 165 |
| Paris, FR | 147 |
| University of Stellenboschlocation not on record | 145 |
| Canberra, AU | 137 |
| MeiseBGlocation not on record | 122 |
| Kensington, AU | 120 |
| Université de Strasbourglocation not on record | 116 |
| Museo Entomologico de Leonlocation not on record | 107 |
| Adelaide, AU | 103 |
| Smithfield, AU | 92 |
| Salvador, BR | 86 |
| Durango, MX | 85 |
| Mérida, MX | 79 |
| Nishihara, JP | 77 |
| Tampa, US | 73 |
| National Museum of Natural Sciencelocation not on record | 63 |
| Masindi, UG | 63 |
| Laboratorio de Ictiologialocation not on record | 62 |
| Taipei, TW | 61 |
| Beijing, CN | 61 |
| Mount Annan, AU | 58 |
| Taipei, TW | 58 |
| Nishihara, JP | 56 |
| Brasília, BR | 55 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 54 |
| Mexico City, MX | 54 |
| Guangzhou, CN | 52 |
| UFBAlocation not on record | 51 |
| UnBlocation not on record | 51 |
| Durban, ZA | 47 |
| Guilin, CN | 41 |
| JBRJlocation not on record | 37 |
| Chaguaramas, TT | 34 |
| Feira de Santana, BR | 34 |
| HNBlocation not on record | 33 |
| Honolulu, US | 32 |
| USP-IBlocation not on record | 32 |
| BISHlocation not on record | 32 |
| Universidade Federal do Maranhãolocation not on record | 31 |
| Ivano-Frankivsk, UA | 31 |
| CEPLAClocation not on record | 31 |
| Miami, US | 30 |
| Edinburgh, GB | 29 |
| Cenargenlocation not on record | 29 |
| Brasília, BR | 27 |
| WAGlocation not on record | 27 |
| UNIVASFlocation not on record | 26 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 26 |
| LBVlocation not on record | 25 |
| Kunming, CN | 25 |
| Plocation not on record | 25 |
| Universidade Federal de Sergipe (UFS)location not on record | 25 |
| Bogotá, D.C., CO | 24 |
| Nanjing, CN | 22 |
| Tapachula, MX | 22 |
| Departamento de Sistematica e Ecologialocation not on record | 22 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 21 |
| Chicago, US | 21 |
| Kagoshima, JP | 20 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 20 |
| UFESlocation not on record | 19 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 19 |
| Auckland, NZ | 18 |
| UFMSlocation not on record | 18 |
| Herbier National du Gabonlocation not on record | 17 |
| Taipei, TW | 17 |
| TAIElocation not on record | 17 |
| Museu Paraense Emílio Goeldilocation not on record | 16 |
| National Biodiversity Institute, Costa Ricalocation not on record | 16 |
| Armidale, AU | 16 |
| Odawara, JP | 15 |
| Pondicherry, IN | 15 |
| Mérida, MX | 15 |
| Federal University of Espírito Santolocation not on record | 15 |
| UNESP-RClocation not on record | 14 |
| Berlin, DE | 14 |
| UFMGlocation not on record | 14 |
| St. Augustine, TT | 13 |
| Yaoundé, CM | 13 |
| MAlocation not on record | 12 |
| Campo Grande, BR | 12 |
| Hobart, AU | 12 |
| Nagano City, JP | 12 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 12 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 11 |
| INBIOlocation not on record | 11 |
| James Cook Townsvillelocation not on record | 11 |
| UFRPElocation not on record | 10 |
| Universidade Federal de Goiáslocation not on record | 9 |
| LSFlocation not on record | 9 |
| Xiamen, CN | 9 |
| Changsha, CN | 9 |
| Frankfurt am Main | 9 |
| Santa Cruz de la Sierra, BO | 9 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 9 |
| Austin, US | 8 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 8 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 8 |
| CJBGlocation not on record | 8 |
| San Francisco de Campeche, MX | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Baroda, IN | 8 |
| College Park, US | 7 |
| Wellington, NZ | 7 |
| Bloomington, US | 7 |
| IECOSlocation not on record | 7 |
| Moscow State Universitylocation not on record | 7 |
| Glocation not on record | 7 |
| TNMlocation not on record | 7 |
| Stockholm, SE | 7 |
| IPA/SPlocation not on record | 7 |
| Zürich, CH | 7 |
| Chongqing Museumlocation not on record | 7 |
| BRLUlocation not on record | 7 |
| Fort Worth, US | 7 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Chengdu, CN | 6 |
| Riverside, US | 6 |
| Monastir, TN | 6 |
| Hangzhou, CN | 6 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 6 |
| Santa Teresa, BR | 6 |
| Wuhan, CN | 6 |
| INMAlocation not on record | 6 |
| Bangkok, TH | 6 |
| National Museums of Kenyalocation not on record | 6 |
| Ann Arbor, US | 5 |
| Universidad de Antioquia (UdeA)location not on record | 5 |
| UEPAlocation not on record | 5 |
| Mexico City, MX | 5 |
| Christchurch, NZ | 5 |
| CNF-UFHBlocation not on record | 5 |
| Dresden, DE | 5 |
| Universidade Federal do Espírito Santolocation not on record | 5 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 5 |
| UEMAlocation not on record | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| ESALQlocation not on record | 5 |
| Leiden University Medical Centerlocation not on record | 5 |
| Porto Alegre, BR | 5 |
| Claremont, US | 5 |
| UNICAMPlocation not on record | 5 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 4 |
| Altos de Pipe, VE | 4 |
| Philadelphia, US | 4 |
| Fortaleza, BR | 4 |
| Chapel Hill, US | 4 |
| UFPElocation not on record | 4 |
| Ilhéus, BR | 4 |
| Universidade de São Paulolocation not on record | 4 |
| Guangzhou, CN | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| UNEMATlocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| NMNH-SIlocation not on record | 3 |
| LNBG$location not on record | 3 |
| Institut de Recherche pour le Developpement (IRD)location not on record | 3 |
| UFPIlocation not on record | 3 |
| South Kensington, GB | 3 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Conservatoire Botanique National de Mascarinlocation not on record | 3 |
| Universidad de los Andes (UniAndes)location not on record | 3 |
| Campo Mourão, BR | 3 |
| Porto Velho, BR | 3 |
| SCAUlocation not on record | 3 |
| TAFORI-LSRClocation not on record | 3 |
| URCAlocation not on record | 3 |
| Santarém, BR | 3 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 3 |
| Department of Botany Herbarium Ahmadu Bello University, Zarialocation not on record | 3 |
| Anton de Kom University of Surinamelocation not on record | 3 |
| Shanghai, CN | 3 |
| CASlocation not on record | 3 |
| Jiangxi Agricultural Universitylocation not on record | 3 |
| Jataí / Setor Industrial, BR | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 2 |
| Moscow, US | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Uberlândia, BR | 2 |
| UFOPlocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| Université du Lomélocation not on record | 2 |
| MUFALlocation not on record | 2 |
| Fukushima Universitylocation not on record | 2 |
| Corrientes, AR | 2 |
| Brussels, BE | 2 |
| EL PASO, US | 2 |
| Fredericksburg, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Toyama, JP | 2 |
| Dekalb, US | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Yangling, CN | 2 |
| VALElocation not on record | 2 |
| nlocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Shenzhen, CN | 2 |
| Calabar, NG | 2 |
| San Francisco, US | 2 |
| Guiyang, CN | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Sanda, JP | 2 |
| WTUlocation not on record | 2 |
| León, NI | 2 |
| FPMZBlocation not on record | 2 |
| Sangmiung Universitylocation not on record | 2 |
| Elocation not on record | 2 |
| Uppsala, SE | 2 |
| Clocation not on record | 2 |
| FLASlocation not on record | 2 |
| Chicago, US | 2 |
| Llocation not on record | 2 |
| UNESP-ISlocation not on record | 2 |
| Universidade Estadual Paulistalocation not on record | 1 |
| University of Guyanalocation not on record | 1 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazonialocation not on record | 1 |
| Njala Universitylocation not on record | 1 |
| LDlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| HACAMlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Northridge, US | 1 |
| Angwin, US | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Brisbane Botanic Gardens, Queensland Herbariumlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| St. Paul, US | 1 |
| Shanghai, CN | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Millersville, US | 1 |
| Université de Bordeauxlocation not on record | 1 |
| BMlocation not on record | 1 |
| CIHS-UAClocation not on record | 1 |
| Austin, US | 1 |
| DSMlocation not on record | 1 |
| Wlocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| FJIDClocation not on record | 1 |
| Botanic Gardenlocation not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| Columbia, US | 1 |
| Guatemala City, GT | 1 |
| Boise, US | 1 |
| CEPEC, CEPLAC e Universidade Federal do Sul da Bahialocation not on record | 1 |
| Mississippi State, US | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Seoul, KR | 1 |
| Catholic University of Pekinglocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Cincinnati, US | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| UCAMlocation not on record | 1 |
| Beijing, CN | 1 |
| Central China Normal Universitylocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Guiyang, CN | 1 |
| UEGlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Arusha, TZ | 1 |
| Durham, US | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Vancouver, CA | 1 |
| Cruz das Almas, BR | 1 |
| GHPG$location not on record | 1 |
| La Paz, BO | 1 |
| Barcelona, ES | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Sendai, JP | 1 |
| Burlington, US | 1 |
| UFPRlocation not on record | 1 |
| EFGlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Museu Paraense Emilio Goeldilocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Williamsburg, US | 1 |
| University of Johannesburglocation not on record | 1 |
| Sagamihara, JP | 1 |
| Mlocation not on record | 1 |
| Addis Ababa, ET | 1 |
| UFERSAlocation not on record | 1 |
| Dublin, IE | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Logan, US | 1 |
| Guangxi Medicinal Botanic Gardenlocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| NGCPR01783location not on record | 1 |
| University of Hamburglocation not on record | 1 |
312 institutions · 6 079 of 6 662 vouchered records shown · 581 without an institution code
09Environmental DNA15 detections
Where the DNA of Cassytha filiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.0 °C 13.1–24.1
Seasonal swing summer↔winter9.60 °C
Max temp (day)27.0 °C 18.8–28.1
Min temp (night)17.0 °C 6.80–19.7
Precipitation58.8 mm/mo 21.8–113
Air humidity58.7 % 49.6–59.5
Moisture balance-75.2 mm/mo -92.7–-44.1
Vapour deficit1,077 Pa 873–1,228
Wind speed2.70 m/s 1.90–4.00
Cloud cover27.3 % 20.4–41.7
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.