Apotomis lineana

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records597

Data sources6

Biological traits2

DNA specimens15

eDNA detections0

Sources6 archives

Databases and archives Apotomis lineana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility597 records↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF597 records

DNA & barcodingBOLD15 specimens

01Narrative

Apotomis lineana is a species of moth, belonging to the genus Apotomis. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis lineana has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

31Avariable

38Gmostly conserved

91Avariable

118Cvariable

197Tvariable

214Amostly conserved

271Tvariable

538Avariable

541Tvariable

577Avariable

598Avariable

625Avariable

AACATTATATTTTATTTTCGGTATTTGAGCAGGAATAGTTGGAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes6

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis moestanasame genus1.8%Apotomis apateticanasame genus2.0%Apotomis semifascianasame genus2.0%Apotomis frigidanasame genus2.0%Apotomis inundanasame genus2.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type597 records

Wild obs. + sensor458

Museum / vouchered121

Other18

Origin

Native32

Range

Area of Occupancy AOO1 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 136≤1 km 71≤10 km 231>10 km 3

441 georeferenced · 17 without coordinates

Open the mapobservation + sensor458

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 24≤1 km 29≤10 km 21

74 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	34
Provincia di Livornolocation not on record	16
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	13
Nijmegen, NL	10
Natural History Museum Rotterdamlocation not on record	10
Tartu, EE	5
Philadelphia, US	5
ZSMlocation not on record	4
SLU Artdatabankenlocation not on record	3
Tallinn, EE	2
University of Kaiserslauternlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Salzburg, AT	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
South Kensington, GB	1

17 institutions · 111 of 121 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)