Apotomis semifasciana

(Haworth, 1811) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records2 007

Data sources7

Biological traits2

DNA specimens21

eDNA detections0

Sources7 archives

Databases and archives Apotomis semifasciana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 007 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 007 records

DNA & barcodingBOLD21 specimens

01Narrative

Apotomis semifasciana, the short-barred grey marble, is a moth of the family Tortricidae. It was first described by the English entomologist Adrian Hardy Haworth in 1811.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis semifasciana has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

349Gmostly conserved

541Cmostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCTGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAGTTAGGAAATCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis moestanasame genus1.7%Apotomis frigidanasame genus1.8%Apotomis saucianasame genus2.0%Paracrama dulcissimasame order15.4%Eligma narcissussame order15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 007 records

Wild obs. + sensor1 561

Museum / vouchered416

Other30

Origin

Native6

Range

Area of Occupancy AOO3 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 644≤1 km 365≤10 km 445>10 km 6

1 460 georeferenced · 101 without coordinates

Open the mapobservation + sensor1 561

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 151≤1 km 130≤10 km 94

375 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence416

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	156
Tartu, EE	48
NHMOlocation not on record	41
Kuopio, FI	33
SLU Artdatabankenlocation not on record	29
Philadelphia, US	15
Natural History Museum Rotterdamlocation not on record	10
Stockholm, SE	8
Rovaniemi, FI	7
Zürich, CH	6
Provincia di Livornolocation not on record	6
Salzburg, AT	3
Durban Natural Science Museumlocation not on record	3
DABUHlocation not on record	3
University of Kaiserslauternlocation not on record	2
MZLUlocation not on record	2
Natural History Museum, Londonlocation not on record	2
neflocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Research Collection of Toni Mayrlocation not on record	1
Tallinn, EE	1
Uniwersytet Łódzkilocation not on record	1
Research Collection of Richard Heindellocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
ZMAAlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
Nijmegen, NL	1
South Kensington, GB	1

28 institutions · 386 of 416 vouchered records shown · 30 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apotomis semifasciana

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 007 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Record type2 007 records