Apotomis sauciana

(Frölich, 1828) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records1 419

Data sources10

Biological traits2

DNA specimens87

eDNA detections1

Sources10 archives

Databases and archives Apotomis sauciana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 419 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD87 specimens

Genome at a glanceGoaT · NCBI≈746 Mbp

01Narrative

Apotomis sauciana, the Sutherland long-cloak or Greville's marble, is a moth of the family Tortricidae. It is found in most of Europe, east to the eastern part of the Palearctic realm. The wingspan is 13–16 mm. Adults are on wing from June to August. They fly during the afternoon and evening. The larvae feed on Vaccinium myrtillus and Arctostaphylos species. They feed in spun shoots.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis sauciana has left across the world's sequence archives.

At a glance

DNA specimens87

BINs1

Marker genes1

eDNA detections1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus84 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

40Cmostly conserved

160Gmostly conserved

229Gmostly conserved

400Tmostly conserved

477Gmostly conserved

604Gmostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCTGGAATAGTCGGAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes11

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis moestanasame genus1.7%Apotomis inundanasame genus1.8%Apotomis betuletanasame genus1.8%Apotomis fraterculanasame genus1.8%Apotomis sororculanasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apotomis sauciana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈745 531 533 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apotomis sauciana0.75 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type1 419 records

Wild obs. + sensor946

Museum / vouchered403

Other70

Range

Area of Occupancy AOO3 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 396≤1 km 307≤10 km 175>10 km 2

880 georeferenced · 66 without coordinates

Open the mapobservation + sensor946

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 81≤1 km 174≤10 km 76>10 km 3

334 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence403

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	97
Provincia di Livornolocation not on record	65
Tromsø, NO	30
DanishLepidopterologicalSocietylocation not on record	24
Salzburg, AT	24
Rovaniemi, FI	19
SLU Artdatabankenlocation not on record	18
Tartu, EE	16
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	6
Philadelphia, US	3
ZSMlocation not on record	3
Stockholm, SE	3
Kuopio, FI	3
NTNU-VMlocation not on record	2
RMZlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Zürich, CH	1
Natural History Museum Rotterdamlocation not on record	1
Durban Natural Science Museumlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
neflocation not on record	1
University of Kaiserslauternlocation not on record	1
NMBU:MINAlocation not on record	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
South Kensington, GB	1

25 institutions · 326 of 403 vouchered records shown · 77 without an institution code

09Environmental DNA1 detections

Where the DNA of Apotomis sauciana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 14.0–14.0

Seasonal swing summer↔winter19.8 °C

Max temp (day)18.4 °C

Min temp (night)8.80 °C

Precipitation68.2 mm/mo

Air humidity57.8 %

Moisture balance-36.4 mm/mo

Vapour deficit674 Pa

Wind speed2.00 m/s

Cloud cover33.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apotomis sauciana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 419 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 419 records