Apotomis inundana

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records1 011

Data sources6

Biological traits0

DNA specimens22

eDNA detections0

Sources6 archives

Databases and archives Apotomis inundana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 011 records↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 011 records

DNA & barcodingBOLD22 specimens

01Narrative

Apotomis inundana is a moth of the family Tortricidae. It is found from Fennoscandia to Italy, Bosnia and Herzegovina, Hungary and Romania and from Belgium and Switzerland to the Baltic region and Russia. The wingspan is 20–22 mm. Adults are on wing from June to August.Swedish Moths The larvae feed on Populus tremula.lepiforum.de

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis inundana has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTCGGTATTTGAGCTGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAGTTAGGAAATCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis demissanasame genus1.5%Apotomis moestanasame genus1.8%Apotomis saucianasame genus1.8%Apotomis frigidanasame genus2.0%Paracrama dulcissimasame order15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 011 records

Wild obs. + sensor796

Museum / vouchered201

Other14

Range

Area of Occupancy AOO2 000 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 425≤1 km 241≤10 km 86>10 km 1

753 georeferenced · 43 without coordinates

Open the mapobservation + sensor796

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 80≤1 km 66≤10 km 18

164 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	53
DanishLepidopterologicalSocietylocation not on record	34
Tartu, EE	16
SLU Artdatabankenlocation not on record	13
Provincia di Livornolocation not on record	7
Uniwersytet Łódzkilocation not on record	7
Salzburg, AT	4
Philadelphia, US	4
ZSMlocation not on record	3
Rovaniemi, FI	3
NMBU:MINAlocation not on record	2
Tallinn, EE	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
NTNU-VMlocation not on record	1
Kuopio, FI	1
NTNU University Museum, Department of Natural Historylocation not on record	1

16 institutions · 153 of 201 vouchered records shown · 48 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apotomis inundana

At a glance

Sources6 archives

At a glance

Record type1 011 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 16 geolocated

Record type1 011 records