Apotomis frigidana

(Packard, 1866) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records41

Data sources7

Biological traits0

DNA specimens31

eDNA detections20

Sources7 archives

Databases and archives Apotomis frigidana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD31 specimens

01Narrative

Apotomis frigidana is een vlinder uit de familie bladrollers (Tortricidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1867 door Packard. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis frigidana has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

37Avariable

45Tmostly conserved

57Gvariable

72Gmostly conserved

81Cvariable

84Amostly conserved

99Cvariable

198Amostly conserved

237Amostly conserved

286Tmostly conserved

309Gvariable

312Tmostly conserved

363Tmostly conserved

366Tmostly conserved

381Amostly conserved

516Tvariable

537Avariable

600Tmostly conserved

618Amostly conserved

639Tvariable

ACATTATATTTTATTTTCGGTATTTGAGCTGGAATAATTGGAACTTCTTTAAGATTGTTAATTCGAGCTGAGTTAGGAAACCCAGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BINs2

Most divergent pair2.4%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis apateticanasame genus1.8%Apotomis semifascianasame genus1.8%Apotomis lineanasame genus2.0%Apotomis inundanasame genus2.0%Apotomis betuletanasame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor6

Museum / vouchered35

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced · 2 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 6≤10 km 1>10 km 1

8 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
San Francisco, US	3
Colorado State Universitylocation not on record	3
Cambridge, US	1
KWPlocation not on record	1

5 institutions · 20 of 35 vouchered records shown · 15 without an institution code

09Environmental DNA20 detections

Where the DNA of Apotomis frigidana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

Mixed habitat1. Forest|1.2 Subarctic Forest1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland | 1.1 Boreal Forest4. Native Grassland|4.2 Subarctic GrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 9.60–16.4

Seasonal swing summer↔winter31.4 °C

Max temp (day)17.3 °C 13.8–22.4

Min temp (night)7.00 °C 5.60–9.70

Precipitation88.0 mm/mo 50.9–105

Air humidity56.0 % 53.4–63.0

Moisture balance-24.9 mm/mo -68.7–-12.4

Vapour deficit628 Pa 441–875

Wind speed2.30 m/s 0.9–3.90

Cloud cover44.0 % 35.4–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)