Apotomis infida

(Heinrich, 1926) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records2 029

Data sources8

Biological traits2

DNA specimens73

eDNA detections92

Sources8 archives

Databases and archives Apotomis infida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 029 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 029 records

Environmental DNA3 datasets · 7 countries92 detections

DNA & barcodingBOLD73 specimens

01Narrative

Apotomis infida is a moth of the family Tortricidae. It is found from Great Britain east to Russia and from Fennoscandia south to France, Italy and Slovakia. It is also found in North America, where it has been recorded from Michigan, Ontario, Quebec, Alberta, British Columbia, California and Colorado. The wingspan is 17–19 mm. Adults are on wing from June to August in North America. The larvae feed on various Salix species, including Salix purpurea, Salix alba, Salix triandra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis infida has left across the world's sequence archives.

At a glance

DNA specimens73

BINs2

Marker genes1

eDNA detections92

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

46Tvariable

82Cvariable

85Avariable

118Cmostly conserved

160Gvariable

214Amostly conserved

250Tvariable

268Avariable

292Tvariable

349Cvariable

400Cvariable

517Cvariable

541Tvariable

544Tvariable

556Tvariable

562Tmostly conserved

577Avariable

598Cvariable

628Gvariable

641Cvariable

646Cvariable

652Tvariable

AACATTATATTTTATTTTCGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes17

BINs2

Most divergent pair3.5%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis moestanasame genus1.8%Apotomis demissanasame genus2.1%Apotomis saucianasame genus2.3%Apotomis lineanasame genus2.4%Apotomis inundanasame genus2.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 029 records

Wild obs. + sensor1 592

Museum / vouchered410

Other27

Range

Area of Occupancy AOO2 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 781≤1 km 310≤10 km 460

1 551 georeferenced · 41 without coordinates

Open the mapobservation + sensor1 592

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 130≤1 km 111≤10 km 63

304 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence410

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	67
NHMOlocation not on record	44
Tartu, EE	25
St. Paul, US	23
Rovaniemi, FI	21
Kuopio, FI	21
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
Provincia di Livornolocation not on record	18
University of Alberta Museums (UAM)location not on record	11
SLU Artdatabankenlocation not on record	10
DABUHlocation not on record	10
NTNU-VMlocation not on record	9
Philadelphia, US	8
Salzburg, AT	8
RMZlocation not on record	5
San Francisco, US	4
New Haven, US	3
Metsähallituslocation not on record	3
Royal Saskatchewan Museumlocation not on record	3
East Lansing, US	3
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	3
ZSMlocation not on record	2
Tallinn, EE	1
ZMAAlocation not on record	1
neflocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Mississippi State, US	1
Stockholm, SE	1
BioFokuslocation not on record	1
Colorado State Universitylocation not on record	1

30 institutions · 329 of 410 vouchered records shown · 81 without an institution code

09Environmental DNA92 detections

Where the DNA of Apotomis infida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys3

Countries7

Verifiable raw sequence linked44

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map7 countries0

mossy spruce forestcreek marginWetland1. Forest & Woodland | 1.1 Boreal Forest4. Native Grassland|4.2 Subarctic Grasslandblack spruce bog, lakeshore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 7.70–16.2

Seasonal swing summer↔winter23.7 °C

Max temp (day)17.2 °C 11.2–19.9

Min temp (night)9.10 °C 1.50–11.9

Precipitation99.9 mm/mo 58.4–173

Air humidity59.0 % 55.7–64.3

Moisture balance0.1 mm/mo -46.9–71.0

Vapour deficit671 Pa 376–761

Wind speed2.70 m/s 1.90–3.80

Cloud cover48.7 % 36.9–59.1

CHELSA 1981–2010, ~9 km grid, at location & month of 92 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apotomis infida

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type2 029 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 029 records