Aphthona nonstriata

(Goeze, 1777) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records6 622

Data sources8

Biological traits2

DNA specimens51

eDNA detections92

Sources8 archives

Databases and archives Aphthona nonstriata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 622 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF6 622 records

Environmental DNA4 datasets · 11 countries92 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

De lisaardvlo is een keversoort uit de familie bladkevers (Chrysomelidae), die tot de tribus Alticini behoort. De wetenschappelijke naam van de soort werd in 1777 gepubliceerd door Johann August Ephraim Goeze. De soort komt van nature voor in Europa en Klein-Azië, een groot deel van het Midden-Oosten, Centraal-Azië en China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona nonstriata has left across the world's sequence archives.

At a glance

DNA specimens51

BINs3

Marker genes2

eDNA detections92

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

7Avariable

85Cmostly conserved

88Gmostly conserved

112Cvariable

127Cvariable

263Cvariable

271Gvariable

274Tmostly conserved

292Tmostly conserved

301Avariable

316Cvariable

322Gvariable

349Gvariable

355Gmostly conserved

368Gmostly conserved

478Amostly conserved

520Gmostly conserved

532Gmostly conserved

574Amostly conserved

578Tmostly conserved

637Avariable

AACTTTATATTTTATTTTTGGGATTTGATCAGGTATAGTAGGAACATCTCTAAGAATATTAATTCGTACTGAATTAGGAAGACCCGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes15

BINs3

Most divergent pair3.0%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphthona euphorbiaesame genus13.6%Aphthona herbigradasame genus14.3%Aphthona venustulasame genus14.6%Aphthona melancholicasame genus15.0%Aphthona pallidasame genus15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aphthona nonstriata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

2n 231×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type6 622 records

Wild obs. + sensor5 443

Museum / vouchered1 143

Fossil36

Range

Area of Occupancy AOO12 540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2 057≤1 km 1 167≤10 km 1 574>10 km 14

4 812 georeferenced · 631 without coordinates

Open the mapobservation + sensor5 443

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 239≤1 km 557≤10 km 182>10 km 41

1 019 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence1 143

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	281
Vitoria, ES	270
Helsinki, FI	61
NTNU-VMlocation not on record	48
Tartu, EE	45
Natural History Museum Rotterdamlocation not on record	38
Trondheim, NO	28
Tilburg, NL	18
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	15
Tallinn, EE	15
Oulu, FI	14
CBDClocation not on record	12
neflocation not on record	10
Kuopio, FI	10
Salzburg, AT	9
NMOKlocation not on record	9
Ugentlocation not on record	9
NHMOlocation not on record	8
ZSMlocation not on record	8
Paris, FR	8
Metsähallituslocation not on record	8
South Kensington, GB	7
Muzeum Górnośląskie w Bytomiulocation not on record	7
Olocation not on record	6
Natural History Museum, Londonlocation not on record	5
LSMlocation not on record	5
NCMGlocation not on record	5
TMPMlocation not on record	5
BioFokuslocation not on record	3
Philadelphia, US	3
MZLUlocation not on record	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
Tromsø, NO	1
IFR-DNFlocation not on record	1

35 institutions · 979 of 1 143 vouchered records shown · 164 without an institution code

09Environmental DNA92 detections

Where the DNA of Aphthona nonstriata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys4

Countries11

Verifiable raw sequence linked49

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map11 countries0

mÃ¶kkikylÃ¤n pihapiirirehevÃ¤ merenrantaniittyTeichuferluhtaranta

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 4.70–16.9

Seasonal swing summer↔winter18.3 °C

Max temp (day)15.4 °C 8.90–20.5

Min temp (night)5.90 °C 0.5–13.0

Precipitation49.1 mm/mo 39.5–79.5

Air humidity58.9 % 55.7–62.4

Moisture balance-29.6 mm/mo -55.8–9.40

Vapour deficit570 Pa 354–825

Wind speed3.70 m/s 2.40–4.90

Cloud cover43.7 % 37.6–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 88 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphthona nonstriata

At a glance

Sources8 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 622 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 622 records