Aphthona herbigrada

(Curtis, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records676

Data sources9

Biological traits2

DNA specimens17

eDNA detections17

Sources9 archives

Databases and archives Aphthona herbigrada's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility676 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF676 records

Environmental DNA1 datasets · 4 countries17 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceGoaT · TreeOfSex2n = 28

01Narrative

Aphthona herbigrada is a species of leaf beetles from the subfamily Galerucinae. It is found in Western, Southern and the southern part of Central Europe as well as Algeria. Adult beetles and their larvae feed on leaves of Helianthemum nummularium and Cistaceae species.BioImages: The Virtual Field-Guide (UK)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona herbigrada has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections17

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

43Tvariable

61Amostly conserved

250Cmostly conserved

262Gmostly conserved

295Amostly conserved

316Gvariable

322Amostly conserved

368Gmostly conserved

416Amostly conserved

430Gmostly conserved

433Gvariable

478Amostly conserved

532Tvariable

565Gvariable

578Tmostly conserved

586Avariable

619Gvariable

628Avariable

AACTTTATATTTCATTTTTGGTATTTGATCAGGAATAGTAGGTACATCCTTAAGAATATTAATTCGTACTGAACTCGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes10

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphthona euphorbiaesame genus10.2%Aphthona venustulasame genus12.5%Aphthona pallidasame genus12.8%Aphthona lutescenssame genus13.1%Aphthona melancholicasame genus13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aphthona herbigrada carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records28–302n range29median28mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

2n 304×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type676 records

Wild obs. + sensor558

Museum / vouchered68

Other50

Range

Area of Occupancy AOO1 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 166≤1 km 117≤10 km 88>10 km 2

373 georeferenced · 185 without coordinates

Open the mapobservation + sensor558

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 14≤10 km 3>10 km 1

20 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	22
Provincia di Livornolocation not on record	7
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	6
ZSMlocation not on record	5
CBDClocation not on record	4
Natural History Museum Rotterdamlocation not on record	2
Salzburg, AT	1
NCMGlocation not on record	1

8 institutions · 48 of 68 vouchered records shown · 20 without an institution code

09Environmental DNA17 detections

Where the DNA of Aphthona herbigrada was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map4 countries0

Trockenrasen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 8.70–19.2

Seasonal swing summer↔winter17.9 °C

Max temp (day)16.0 °C 12.3–23.1

Min temp (night)9.10 °C 5.00–13.6

Precipitation67.0 mm/mo 53.5–212

Air humidity62.1 % 58.1–63.9

Moisture balance-10.9 mm/mo -32.8–125

Vapour deficit572 Pa 470–939

Wind speed3.00 m/s 2.00–4.60

Cloud cover41.0 % 33.4–43.6

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)