Aphthona lutescens

(Gyllenhal, 1813) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records3 017

Data sources8

Biological traits2

DNA specimens74

eDNA detections159

Sources8 archives

Databases and archives Aphthona lutescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 017 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI159 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 017 records

Environmental DNA3 datasets · 13 countries159 detections

DNA & barcodingBOLD74 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Aphthona lutescens is een keversoort uit de familie bladkevers (Chrysomelidae). De wetenschappelijke naam van de soort werd in 1808 gepubliceerd door Leonard Gyllenhaal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona lutescens has left across the world's sequence archives.

At a glance

DNA specimens74

BINs1

Marker genes2

eDNA detections159

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

143Cmostly conserved

314Gmostly conserved

CATTATATTTTATTTTTGGGATTTGATCAGGAATAGTAGGAACTTCCTTAAGAGTATTAATTCGAACAGAATTAGGTAATCCAGGATCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes16

BIN1

Most divergent pair2.6%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphthona marshallisame genus11.9%Longitarsus atricillussame family13.0%Aphthona cyparissiaesame genus13.1%Psylliodes cupreasame family14.5%Psilalcis isombrasame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aphthona lutescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

08Occurrence & distribution

Record type3 017 records

Wild obs. + sensor1 955

Museum / vouchered1 026

Fossil2

Other34

Range

Area of Occupancy AOO6 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 922≤1 km 437≤10 km 257>10 km 4

1 620 georeferenced · 335 without coordinates

Open the mapobservation + sensor1 955

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 204≤1 km 425≤10 km 256>10 km 24

909 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence1 026

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	285
Tartu, EE	233
Vitoria, ES	108
Helsinki, FI	64
Metsähallituslocation not on record	31
NTNU-VMlocation not on record	29
Tallinn, EE	27
Trondheim, NO	24
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	17
Provincia di Livornolocation not on record	17
TMPMlocation not on record	12
Philadelphia, US	12
Salzburg, AT	11
Natural History Museum Rotterdamlocation not on record	8
Oulu, FI	7
LSMlocation not on record	7
Ugentlocation not on record	7
CBDClocation not on record	6
South Kensington, GB	6
Kuopio, FI	5
Tilburg, NL	4
neflocation not on record	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	3
MZLUlocation not on record	3
BioFokuslocation not on record	2
Wellcome Sanger Institutelocation not on record	2
Paris, FR	2
Stockholm, SE	2
Tromsø, NO	1
IFR-DNFlocation not on record	1
NMOKlocation not on record	1
NCMGlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Winterthur, CH	1

34 institutions · 944 of 1 026 vouchered records shown · 82 without an institution code

09Environmental DNA159 detections

Where the DNA of Aphthona lutescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found159

Studies independent surveys3

Countries13

Verifiable raw sequence linked90

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 159 detections have coordinates

Open the map13 countries0

1. Forest & Woodland | 1.4. Temperate ForestRoncier bord de chemin cotier

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 9.40–16.9

Seasonal swing summer↔winter18.0 °C

Max temp (day)15.8 °C 12.4–20.2

Min temp (night)8.30 °C 5.60–13.6

Precipitation64.9 mm/mo 40.8–127

Air humidity59.3 % 56.7–62.4

Moisture balance-38.3 mm/mo -60.3–19.0

Vapour deficit585 Pa 447–810

Wind speed3.10 m/s 2.50–4.30

Cloud cover43.6 % 38.8–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 156 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphthona lutescens

At a glance

Sources8 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 017 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 017 records