Aphthona euphorbiae

(Schrank, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records5 266

Data sources7

Biological traits2

DNA specimens249

eDNA detections515

Sources7 archives

Databases and archives Aphthona euphorbiae's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 266 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI515 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics249 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 266 records

Environmental DNA3 datasets · 13 countries515 detections

DNA & barcodingBOLD249 specimens

01Narrative

Aphthona euphorbiae is a root-feeding flea beetle of the genus Aphthona. It is widely distributed throughout Europe, North Africa, the Caucasuses, Near East, Asia Minor, the southern part of West and Mid Siberia and Kazakhstan. In Latvia it has been reported as a pest of flax Linum.Palij, V. F. 1958. On the fauna and biocenology of Latvian flea beetles (Coleoptera, Chrysomelidae, Halticinae). Proceedings of the Institute of Biology of the Latvian SSR Academy of Sciences 5: 69–89. [Палий, В. Ф. 1958. О фауне и биоценологии земляных блошек Латвии (Coleoptera, Chrysomelidae, Halticinae). Труды Института биологии Академии наук Латвийской ССР 5: 69–89.]

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding249 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona euphorbiae has left across the world's sequence archives.

At a glance

DNA specimens249

BINs1

Marker genes3

eDNA detections515

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus238 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

5Amostly conserved

53Gmostly conserved

80Tmostly conserved

261Cmostly conserved

315Amostly conserved

368Cmostly conserved

407Amostly conserved

620Cmostly conserved

CTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCATTAAGGATACTAATTCGTACTGAATTAGGAAGTCCTGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes14

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphthona herbigradasame genus10.2%Aphthona venustulasame genus11.0%Aphthona melancholicasame genus11.3%Aphthona pallidasame genus12.4%Aphthona violaceasame genus13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type5 266 records

Wild obs. + sensor3 984

Museum / vouchered1 221

Cultivated / captive1

Fossil1

Other59

Origin

Native1

Range

Area of Occupancy AOO10 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 1 615≤1 km 1 033≤10 km 1 000

3 648 georeferenced · 336 without coordinates

Open the mapobservation + sensor3 984

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 174≤1 km 712≤10 km 187>10 km 9

1 082 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence1 221

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	541
SLU Artdatabankenlocation not on record	287
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	65
Natural History Museum Rotterdamlocation not on record	49
Provincia di Livornolocation not on record	14
Helsinki, FI	14
NMOKlocation not on record	13
South Kensington, GB	12
NTNU-VMlocation not on record	11
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	7
Trondheim, NO	6
Wellcome Sanger Institutelocation not on record	6
UGRlocation not on record	5
Natural History Museum, Londonlocation not on record	5
Salzburg, AT	5
MZLUlocation not on record	4
Philadelphia, US	4
Tilburg, NL	4
ZSMlocation not on record	4
Oulu, FI	3
IFR-DNFlocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Metsähallituslocation not on record	1
CBDClocation not on record	1
Olocation not on record	1
Stockholm, SE	1
LSMlocation not on record	1
NCMGlocation not on record	1
Ugentlocation not on record	1

31 institutions · 1 072 of 1 221 vouchered records shown · 148 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA515 detections

Where the DNA of Aphthona euphorbiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found515

Studies independent surveys3

Countries13

Verifiable raw sequence linked287

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 515 detections have coordinates

Open the map13 countries0

1. Forest & Woodland | 1.4. Temperate ForestStreuobstwiese3. Shrubland|3.8. Shrubland - Mediterranean-…UrbanKiefernÃ¤ste14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 4.60–17.0

Seasonal swing summer↔winter18.3 °C

Max temp (day)14.9 °C 6.90–20.7

Min temp (night)7.70 °C 1.20–13.2

Precipitation58.0 mm/mo 34.4–76.0

Air humidity61.3 % 56.3–67.3

Moisture balance-21.3 mm/mo -64.0–25.7

Vapour deficit535 Pa 265–780

Wind speed3.80 m/s 2.50–5.10

Cloud cover47.6 % 40.7–53.9

CHELSA 1981–2010, ~9 km grid, at location & month of 510 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphthona euphorbiae

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type5 266 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 266 records