Aphthona melancholica

Weise, 1888 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records247

Data sources7

Biological traits2

DNA specimens12

eDNA detections3

Sources7 archives

Databases and archives Aphthona melancholica's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility247 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF247 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD12 specimens

01Narrative

Aphthona melancholicaAphthona melancholica is a species of leaf beetles in the subfamily Galerucinae. It is found on the Iberian Peninsula and in England. Adult beetles and their larvae feed on leaves of Euphorbia species (Euphorbiaceae).BioImages : The Virtual Field-Guide (UK)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona melancholica has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes3

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

2Cvariable

9Cvariable

13Tvariable

21Tvariable

22Tmostly conserved

74Gmostly conserved

158Gmostly conserved

163Gmostly conserved

226Gvariable

358Tmostly conserved

TCTATATTCTATTTTTGGAATTTGATCAGGAATAATTGGAACTTCCTTAAGTATATTAATTCGTACTGAATTAGGAAGTCCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes5

BIN1

Most divergent pair0.92%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphthona euphorbiaesame genus11.3%Aphthona albertinaesame genus11.6%Aphthona pallidasame genus12.4%Aphthona herbigradasame genus13.1%Longitarsus tabidussame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type247 records

Wild obs. + sensor232

Museum / vouchered15

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 67≤1 km 82≤10 km 81

230 georeferenced · 2 without coordinates

Open the mapobservation + sensor232

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 1≤1 km 5≤10 km 8

14 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CBDClocation not on record	9
NCMGlocation not on record	2
Vitoria, ES	1

3 institutions · 12 of 15 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Aphthona melancholica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)