Aphonopelma vorhiesi

(Chamberlin & Ivie, 1939) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Aphonopelma

At a glance

Occurrence records322

Data sources9

Biological traits24

DNA specimens33

eDNA detections34

Sources9 archives

Databases and archives Aphonopelma vorhiesi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility322 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

World Spider Trait DBMasaryk University24 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF322 records

Environmental DNA1 datasets · 1 countries34 detections

DNA & barcodingBOLD33 specimens

01Narrative

Aphonopelma vorhiesi is a species of spider in the family Theraphosidae, found in United States (Arizona and New Mexico).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWolff et al. 2022Punzo & Henderson 1999Hamilton et al. 2016b

Morphometry20

Cephalothorax length16.38 mm

Cephalothorax width14.63 mm

Femur I length12.61 mm

Femur III length10.52 mm

Femur IV length12.91 mm

Leg I length43.34 mm

Leg III length37.6 mm

Leg IV length47.58 mm

Metatarsus I length8.17 mm

Metatarsus III length8.13 mm

Metatarsus IV length11.47 mm

Patella I length6.22 mm

Patella III length4.53 mm

Patella IV length5.19 mm

Tarsus I length6.37 mm

Tarsus III length6.72 mm

Tarsus IV length7.32 mm

Tibia I length9.97 mm

Tibia III length7.7 mm

Tibia IV length10.69 mm

Predation2

Hunting guild 2burrower

Web buildingyes

Biomechanics1

'Primary mode of locomotionwalking

Morphology1

Cribellumabsent

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphonopelma vorhiesi has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections34

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P897 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

689Gmostly conserved

876Gvariable

881Tmostly conserved

TTTTGTCATCGTTGACTGATGTTGGGGTGGGGGCTGGGTGAACTATTTATCCCCCCTTGTCTTCTTTTGTTGGTCATTCTGGAGGTGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes11

BIN1

Most divergent pair0.45%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphonopelma chalcodessame genus5.1%Aphonopelma eutylenumsame genus8.0%Aphonopelma iodiussame genus8.5%Brachypelma smithisame family10.6%Aphonopelma marxisame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type322 records

Wild obs. + sensor320

Museum / vouchered2

Range

Area of Occupancy AOO864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 184≤1 km 39≤10 km 19>10 km 27

269 georeferenced · 51 without coordinates

Open the mapobservation + sensor320

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	1
Denver, US	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA34 detections

Where the DNA of Aphonopelma vorhiesi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)