Aphonopelma chalcodes

Chamberlin, 1940 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Aphonopelma

At a glance

Occurrence records2 177

Data sources9

Biological traits1

DNA specimens63

eDNA detections71

Sources9 archives

Databases and archives Aphonopelma chalcodes's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 177 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics63 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 177 records

Environmental DNA1 datasets · 0 countries71 detections

DNA & barcodingBOLD63 specimens

01Narrative

Aphonopelma chalcodes, commonly known as the western desert tarantula, Arizona blond tarantula or Mexican blond tarantula is a species of spider belonging to the family Theraphosidae. It has a limited distribution in the deserts of Arizona and adjacent parts of Mexico but can be very common within this range. The common name "blond tarantula" refers to the carapace, which is densely covered in pale hairs, and contrasts strongly with the all-dark legs and abdomen. Additionally, these spiders have low toxicity, a long life expectancy, and several offspring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014a

Ecology1

Circadian activitynocturnal

05DNA & barcoding63 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphonopelma chalcodes has left across the world's sequence archives.

At a glance

DNA specimens63

Marker genes1

eDNA detections71

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P897 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

5Gvariable

14Gmostly conserved

26Gmostly conserved

35Tmostly conserved

38Gmostly conserved

56Cmostly conserved

62Tmostly conserved

77Cmostly conserved

89Amostly conserved

113Amostly conserved

143Tmostly conserved

179Tmostly conserved

200Amostly conserved

209Amostly conserved

218Amostly conserved

245Amostly conserved

248Gmostly conserved

251Amostly conserved

260Gmostly conserved

269Amostly conserved

272Amostly conserved

275Gmostly conserved

296Gmostly conserved

380Cvariable

413Gmostly conserved

419Avariable

422Amostly conserved

423Amostly conserved

437Tvariable

479Gmostly conserved

509Avariable

515Gmostly conserved

524Gmostly conserved

527Amostly conserved

539Gmostly conserved

551Gmostly conserved

554Gmostly conserved

560Amostly conserved

596Amostly conserved

611Amostly conserved

614Amostly conserved

650Tmostly conserved

704Gmostly conserved

713Tmostly conserved

716Gmostly conserved

719Amostly conserved

728Gmostly conserved

833Gmostly conserved

836Gmostly conserved

839Tmostly conserved

845Amostly conserved

869Gmostly conserved

893Gmostly conserved

TTTTGTCATCATTGACTGATGTTGGGGTGGGAGCTGGGTGAACTATTTATCCACCCTTGTCTTCTTTTGTTGGTCACTCTGGAGGTGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes36

BINs0

Most divergent pair4.5%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphonopelma vorhiesisame genus5.1%Aphonopelma eutylenumsame genus8.2%Aphonopelma iodiussame genus8.2%Aphonopelma marxisame genus11.1%Aphonopelma armadasame genus11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 177 records

Wild obs. + sensor2 142

Museum / vouchered35

Range

Area of Occupancy AOO4 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 107≤1 km 280≤10 km 127>10 km 256

1 770 georeferenced · 372 without coordinates

Open the mapobservation + sensor2 142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 32>10 km 2

34 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Luis Potosí, MX	32
Denver, US	2
Chicago, US	1

3 institutions · 35 of 35 vouchered records shown

09Environmental DNA71 detections

Where the DNA of Aphonopelma chalcodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphonopelma chalcodes

At a glance

Sources9 archives

Ecology1

At a glance

Record type2 177 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 177 records