Aphonopelma eutylenum

Chamberlin, 1940 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Aphonopelma

At a glance

Occurrence records861

Data sources8

Biological traits2

DNA specimens37

eDNA detections37

Sources8 archives

Databases and archives Aphonopelma eutylenum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility861 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

World Spider Trait DBMasaryk University2 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF861 records

Environmental DNA1 datasets · 0 countries37 detections

DNA & barcodingBOLD37 specimens

01Narrative

Aphonopelma eutylenum, commonly called California ebony tarantula, is a species of spider in the family Theraphosidae, found in the United States (California).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGreenstone & Bennett 1980

Morphometry1

Body mass11.86 mm

Physiology1

Resting metabolic rate0.003 mm

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphonopelma eutylenum has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections37

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P897 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

8Amostly conserved

35Tvariable

38Gmostly conserved

44Tmostly conserved

83Gmostly conserved

89Gmostly conserved

125Gmostly conserved

128Tmostly conserved

137Cmostly conserved

140Gmostly conserved

149Amostly conserved

167Amostly conserved

192Tmostly conserved

200Amostly conserved

202Gmostly conserved

209Gvariable

230Gmostly conserved

236Tmostly conserved

239Cmostly conserved

242Gvariable

245Gmostly conserved

263Tvariable

278Tmostly conserved

284Amostly conserved

326Tmostly conserved

338Tmostly conserved

350Amostly conserved

392Amostly conserved

401Amostly conserved

419Avariable

458Gmostly conserved

479Tmostly conserved

506Amostly conserved

508Gvariable

515Gmostly conserved

521Amostly conserved

539Gmostly conserved

551Tmostly conserved

560Avariable

581Amostly conserved

590Tmostly conserved

611Amostly conserved

662Amostly conserved

692Amostly conserved

716Amostly conserved

743Cmostly conserved

761Tmostly conserved

764Gmostly conserved

767Tmostly conserved

806Avariable

815Gmostly conserved

876Avariable

878Gmostly conserved

881Tmostly conserved

887Gmostly conserved

TTTTGTCATCATTGACTGATGTTGGGGTTGGGGCTGGGTGAACTATTTATCCCCCTTTGTCTTCTTTTGTTGGTCATTCTGGGGGGGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes17

BIN1

Most divergent pair5.9%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphonopelma iodiussame genus5.4%Aphonopelma vorhiesisame genus8.0%Aphonopelma chalcodessame genus8.2%Brachypelma smithisame family10.3%Aphonopelma armadasame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type861 records

Wild obs. + sensor856

Museum / vouchered5

Range

Area of Occupancy AOO1 964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 471≤1 km 129≤10 km 40>10 km 51

691 georeferenced · 165 without coordinates

Open the mapobservation + sensor856

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 4

5 georeferenced

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	4
Cambridge, US	1

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA37 detections

Where the DNA of Aphonopelma eutylenum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)