Aphonopelma marxi

(Simon, 1891) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Aphonopelma

At a glance

Occurrence records553

Data sources10

Biological traits0

DNA specimens28

eDNA detections28

Sources10 archives

Databases and archives Aphonopelma marxi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility553 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF553 records

Environmental DNA1 datasets · 0 countries28 detections

DNA & barcodingBOLD28 specimens

Genome at a glanceGoaT · NCBI≈6.5 Gbp

01Narrative

Aphonopelma marxi is a species of spider in the family Theraphosidae (tarantulas), found in United States (Arizona, New Mexico, Colorado and Utah). Aphonopelma behlei and A. vogelae, at one time considered separate species, are now considered to be synonyms.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphonopelma marxi has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections28

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P897 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 56 variable positions, in barcode order

2Cvariable

21Gmostly conserved

22Tmostly conserved

23Gvariable

29Amostly conserved

32Gmostly conserved

59Amostly conserved

62Cvariable

89Gmostly conserved

101Tmostly conserved

122Tmostly conserved

188Avariable

206Amostly conserved

233Tmostly conserved

260Tmostly conserved

281Tmostly conserved

284Tmostly conserved

287Gmostly conserved

288Tmostly conserved

299Cmostly conserved

314Cmostly conserved

329Amostly conserved

380Avariable

386Cmostly conserved

419Tvariable

422Amostly conserved

479Gmostly conserved

494Gmostly conserved

506Gmostly conserved

548Tmostly conserved

551Gmostly conserved

572Tmostly conserved

596Cmostly conserved

632Amostly conserved

633Amostly conserved

647Cmostly conserved

650Amostly conserved

656Cmostly conserved

662Gmostly conserved

678Amostly conserved

683Gmostly conserved

698Gmostly conserved

707Tmostly conserved

710Cvariable

716Gmostly conserved

728Amostly conserved

735Tmostly conserved

743Tmostly conserved

761Gmostly conserved

794Tmostly conserved

833Amostly conserved

840Tmostly conserved

845Gmostly conserved

863Tmostly conserved

881Tvariable

896Amostly conserved

TCTTATCGTCGTTGACAGATGTGGGGGTAGGGGCTGGGTGGACTATTTATCCCCCCTTATCCTCTTTTGTTGGGCACTCTGGGGGTGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes15

BIN1

Most divergent pair2.7%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphonopelma chalcodessame genus11.1%Aphonopelma vorhiesisame genus11.4%Brachypelma emiliasame family11.4%Brachypelma hamoriisame family11.7%Aphonopelma eutylenumsame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphonopelma marxi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈6 491 949 921 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Aphonopelma marxi6.49 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type553 records

Wild obs. + sensor520

Museum / vouchered33

Range

Area of Occupancy AOO1 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 281≤1 km 60≤10 km 43>10 km 48

432 georeferenced · 88 without coordinates

Open the mapobservation + sensor520

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	16
München, DE	9
La Paz, MX	5
Cambridge, US	1
ERWClocation not on record	1
Frankfurt am Main	1

6 institutions · 33 of 33 vouchered records shown

09Environmental DNA28 detections

Where the DNA of Aphonopelma marxi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)