Apamea inordinata

Morrison, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records407

Data sources7

Biological traits0

DNA specimens32

eDNA detections32

Sources7 archives

Databases and archives Apamea inordinata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility407 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF407 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD32 specimens

01Narrative

Apamea inordinata is a moth of the family Noctuidae. It is found in the United States, including New York, Massachusetts, Pennsylvania, Colorado, and California. In Canada it is found in Ontario, Quebec, New Brunswick, Nova Scotia, British Columbia, Alberta, Saskatchewan and Manitoba. Its wingspan is about 34 mm. The species is listed as threatened in Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved 19 January 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea inordinata has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

85Cmostly conserved

103Cmostly conserved

106Cmostly conserved

127Tmostly conserved

139Tmostly conserved

160Gmostly conserved

235Tmostly conserved

271Cmostly conserved

274Cmostly conserved

328Amostly conserved

382Gmostly conserved

412Amostly conserved

421Tmostly conserved

427Cmostly conserved

500Tmostly conserved

505Cmostly conserved

511Amostly conserved

538Gmostly conserved

616Cmostly conserved

628Gmostly conserved

634Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCTTTAAGACTCTTAATTCGTGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes4

BINs2

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea leucodonsame genus3.8%Apamea cinefactasame genus5.2%Apamea spaldingisame genus5.2%Argyrospila succineasame family5.2%Apamea cogitatasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type407 records

Wild obs. + sensor60

Museum / vouchered347

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 35≤1 km 10≤10 km 6>10 km 2

53 georeferenced · 7 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 108≤1 km 23≤10 km 57>10 km 11

199 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence347

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	149
East Lansing, US	66
University of Alberta Museums (UAM)location not on record	58
New Haven, US	24
Royal Saskatchewan Museumlocation not on record	14
Mississippi State, US	12
King Saud Universitylocation not on record	1
UDlocation not on record	1

8 institutions · 325 of 347 vouchered records shown · 22 without an institution code

09Environmental DNA32 detections

Where the DNA of Apamea inordinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 11.1–16.9

Seasonal swing summer↔winter24.9 °C

Max temp (day)20.5 °C 17.4–24.1

Min temp (night)7.20 °C 4.40–10.5

Precipitation27.5 mm/mo 27.5–46.1

Air humidity52.8 % 52.0–52.9

Moisture balance-94.0 mm/mo -103–-72.6

Vapour deficit764 Pa 623–928

Wind speed2.70 m/s 2.00–4.10

Cloud cover41.4 % 38.6–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)