Apamea spaldingi

Smith, 1909 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records617

Data sources7

Biological traits0

DNA specimens25

eDNA detections24

Sources7 archives

Databases and archives Apamea spaldingi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility617 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF617 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD25 specimens

01Narrative

Apamea spaldingi, or Spalding's Quaker, is a moth of the family Noctuidae. The species was first described by John Bernhardt Smith in 1909. It is native to interior western North America."Apamea spaldingi (Smith, 1909)". Pacific Northwest Moths. Retrieved November 16, 2020. The forewing length is up to 20 millimetres. It is mottled and streaked grey with lighter hindwings and is somewhat variable. The flight season is early for Apamea species, beginning in April in some areas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea spaldingi has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

601Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCTTTAAGACTTTTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea cinefactasame genus4.1%Apamea leucodonsame genus4.3%Apamea alticolasame genus4.9%Apamea zetasame genus4.9%Margelana versicolorsame family4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type617 records

Wild obs. + sensor37

Museum / vouchered580

Range

Area of Occupancy AOO804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 3≤1 km 9≤10 km 11>10 km 3

26 georeferenced · 11 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 234≤1 km 40≤10 km 68>10 km 21

363 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence580

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	388
New Haven, US	35
Oregon State Arthropod Collectionlocation not on record	32
University of Alberta Museums (UAM)location not on record	31
Vernal, US	24
Mississippi State, US	22
San Diego, US	16
ASUlocation not on record	8
Denver, US	4
East Lansing, US	2
St. Paul, US	2
WWUlocation not on record	1
US	1

13 institutions · 566 of 580 vouchered records shown · 14 without an institution code

09Environmental DNA24 detections

Where the DNA of Apamea spaldingi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 11.0–16.7

Seasonal swing summer↔winter23.5 °C

Max temp (day)18.6 °C 17.4–23.5

Min temp (night)4.90 °C 4.00–10.9

Precipitation35.3 mm/mo 29.2–73.7

Air humidity52.7 % 48.3–54.9

Moisture balance-74.9 mm/mo -117–-61.6

Vapour deficit666 Pa 623–964

Wind speed2.20 m/s 2.00–3.30

Cloud cover40.2 % 30.6–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)