Apamea cinefacta

Grote, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records356

Data sources7

Biological traits0

DNA specimens42

eDNA detections43

Sources7 archives

Databases and archives Apamea cinefacta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility356 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF356 records

Environmental DNA1 datasets · 2 countries43 detections

DNA & barcodingBOLD42 specimens

01Narrative

Apamea cinefacta is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1881. It is found in western North America, including in Washington and Alberta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea cinefacta has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections43

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

20Gmostly conserved

22Amostly conserved

427Tmostly conserved

562Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCTTTAAGACTCTTAATTCGTGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea spaldingisame genus4.1%Apamea leucodonsame genus4.3%Apamea cogitatasame genus4.7%Apamea ferragosame genus4.7%Apamea oblongasame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type356 records

Wild obs. + sensor32

Museum / vouchered324

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 7≤1 km 8≤10 km 9

24 georeferenced · 8 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 43≤1 km 23≤10 km 61>10 km 76

203 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	103
Oregon State Arthropod Collectionlocation not on record	76
Colorado State Universitylocation not on record	46
New Haven, US	42
University of Alberta Museums (UAM)location not on record	23
Vernal, US	10
Denver, US	5
Edmonton, CA	4
University of California, Davislocation not on record	4
University of California, Davis, Bohart Museum of Entomologylocation not on record	4
San Francisco, US	3
Essig Museum of Entomologylocation not on record	3
ASUlocation not on record	1

13 institutions · 324 of 324 vouchered records shown

09Environmental DNA43 detections

Where the DNA of Apamea cinefacta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map2 countries0

Pines

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.9–17.2

Seasonal swing summer↔winter14.8 °C

Max temp (day)18.5 °C 15.5–25.2

Min temp (night)7.10 °C 4.90–10.2

Precipitation33.9 mm/mo 10.8–79.2

Air humidity53.9 % 50.3–61.0

Moisture balance-83.1 mm/mo -155–-31.2

Vapour deficit640 Pa 545–917

Wind speed2.60 m/s 1.80–3.80

Cloud cover32.8 % 26.4–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)