Apamea cogitata

Smith, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records1 634

Data sources7

Biological traits0

DNA specimens220

eDNA detections222

Sources7 archives

Databases and archives Apamea cogitata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 634 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI222 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics220 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 634 records

Environmental DNA1 datasets · 2 countries222 detections

DNA & barcodingBOLD220 specimens

01Narrative

Apamea cogitata, the thoughtful apamea, is a moth of the family Noctuidae. It is native to North America, where it can be found across Canada from Newfoundland to British Columbia and the Northwest Territories, and in the western United States to California. The wingspan is about 40 mm. Adults are on wing from June to September depending on the location. There is one generation per year. This was formerly considered to be a subspecies of Apamea dubitans.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding220 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea cogitata has left across the world's sequence archives.

At a glance

DNA specimens220

BINs1

Marker genes1

eDNA detections222

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus212 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

229Gmostly conserved

274Cmostly conserved

284Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAACTCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes15

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea kuusamoensissame genus2.7%Apamea devastatorsame genus2.7%Apamea inficitasame genus2.9%Apamea oblongasame genus2.9%Apamea ferragosame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 634 records

Wild obs. + sensor542

Museum / vouchered1 092

Range

Area of Occupancy AOO2 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 421≤1 km 40≤10 km 16>10 km 8

485 georeferenced · 57 without coordinates

Open the mapobservation + sensor542

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 231≤1 km 124≤10 km 80>10 km 10

445 georeferenced · 647 without coordinates

Open the institutions mapphysical evidence1 092

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	234
Edmonton, CA	143
University of Alberta Museums (UAM)location not on record	141
Oregon State Arthropod Collectionlocation not on record	134
University of Guelph, Centre for Biodiversity Genomicslocation not on record	79
New Haven, US	55
Vernal, US	40
Royal Saskatchewan Museumlocation not on record	33
RBINS-Scientific Heritagelocation not on record	9
Brussels, BE	9
East Lansing, US	9
St. Paul, US	6
DOI/FWS, Kenai National Wildlife Refugelocation not on record	5
Washington, US	4
WWUlocation not on record	2
Toronto, CA	2
KWPlocation not on record	2
Denver, US	1
Centre for Biodiversity Genomicslocation not on record	1
University of Alaska Museumlocation not on record	1
University of California, Davislocation not on record	1

21 institutions · 911 of 1 092 vouchered records shown · 181 without an institution code

09Environmental DNA222 detections

Where the DNA of Apamea cogitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found222

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 222 detections have coordinates

Open the map2 countries0

Mixed habitatMixed Habitat4. Native GrasslandP. glauca forest, distb.GrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 10.7–20.5

Seasonal swing summer↔winter23.9 °C

Max temp (day)21.9 °C 16.3–26.2

Min temp (night)10.9 °C 4.70–15.0

Precipitation61.2 mm/mo 34.8–104

Air humidity55.5 % 51.4–62.8

Moisture balance-75.0 mm/mo -110–19.1

Vapour deficit850 Pa 571–1,117

Wind speed2.00 m/s 1.30–4.20

Cloud cover36.4 % 31.0–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 217 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apamea cogitata

At a glance

Sources7 archives

At a glance

Record type1 634 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 634 records