Apamea inficita

Walker, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records666

Data sources7

Biological traits0

DNA specimens57

eDNA detections57

Sources7 archives

Databases and archives Apamea inficita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility666 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF666 records

Environmental DNA1 datasets · 2 countries57 detections

DNA & barcodingBOLD57 specimens

01Narrative

Apamea inficita, the lined Quaker is a moth of the family Noctuidae. The species was first described by Francis Walker in 1857. It is native to North America, where it can be found from Newfoundland west to British Columbia, north to the Yukon and the Northwest Territories, and south to Colorado. The wingspan is 34–36 mm. The moth is rusty or yellowish brown, or sometimes pinkish in color. It has a darkened spot on the forewings and a disc-shaped spot on the hindwings. The moth flies from July to August depending on the location.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea inficita has left across the world's sequence archives.

At a glance

DNA specimens57

BINs2

Marker genes1

eDNA detections57

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

81Gmostly conserved

85Cmostly conserved

100Tmostly conserved

142Cmostly conserved

220Tmostly conserved

259Tmostly conserved

268Tmostly conserved

400Tmostly conserved

442Tmostly conserved

475Cmostly conserved

487Cmostly conserved

616Tvariable

628Gmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATGGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAGCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes11

BINs2

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea dubitanssame genus2.9%Apamea cogitatasame genus2.9%Apamea kuusamoensissame genus3.3%Apamea contradictasame genus3.3%Apamea zetasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type666 records

Wild obs. + sensor109

Museum / vouchered557

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 44≤1 km 16≤10 km 14>10 km 4

78 georeferenced · 31 without coordinates

Open the mapobservation + sensor109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 127≤1 km 25≤10 km 82>10 km 7

241 georeferenced · 316 without coordinates

Open the institutions mapphysical evidence557

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	173
Colorado State Universitylocation not on record	112
New Haven, US	78
Royal Saskatchewan Museumlocation not on record	51
Edmonton, CA	33
University of Guelph, Centre for Biodiversity Genomicslocation not on record	22
Brussels, BE	9
Albuquerque, US	8
East Lansing, US	7
RBINS-Scientific Heritagelocation not on record	7
Mississippi State, US	6
National Institute of Biological Resourceslocation not on record	3
St. Paul, US	2
Centre for Biodiversity Genomicslocation not on record	2
Vernal, US	1
US	1
University of Alaska Museumlocation not on record	1
WWUlocation not on record	1

18 institutions · 517 of 557 vouchered records shown · 40 without an institution code

09Environmental DNA57 detections

Where the DNA of Apamea inficita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map2 countries0

ForestRiparian ZoneP. glauca forest distb.1. Forest & WoodlandMixed HabitatP. glauca forest, distb.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 1.40–18.5

Seasonal swing summer↔winter25.8 °C

Max temp (day)21.9 °C 5.30–25.5

Min temp (night)9.00 °C -3.30–12.2

Precipitation58.4 mm/mo 30.2–73.2

Air humidity54.2 % 49.9–62.5

Moisture balance-75.0 mm/mo -85.7–6.90

Vapour deficit783 Pa 381–1,044

Wind speed2.20 m/s 1.50–3.20

Cloud cover35.1 % 31.0–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)