Apamea oblonga

(Haworth, 1809) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records8 112

Data sources7

Biological traits2

DNA specimens10

eDNA detections11

Sources7 archives

Databases and archives Apamea oblonga's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 112 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Apamea oblonga, the crescent striped, is a moth of the family Noctuidae. The species was first described by Adrian Hardy Haworth in 1809. It is found in northern and central Europe, east to southern Russia, Asia Minor, Armenia, Turkestan, Turkey, Iran, southern Siberia, northern Pakistan, Mongolia, China (Xinjiang, Heilongjiang, Ningxia), Sakhalin and Japan

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea oblonga has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections11

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

121Tvariable

145Tmostly conserved

364Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea ferragosame genus2.6%Apamea longulasame genus2.9%Apamea cogitatasame genus2.9%Apamea contradictasame genus2.9%Apamea dubitanssame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 112 records

Wild obs. + sensor6 232

Museum / vouchered1 822

Other58

Origin

Native535

Range

Area of Occupancy AOO5 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 1 143≤1 km 531≤10 km 4 026>10 km 19

5 719 georeferenced · 513 without coordinates

Open the mapobservation + sensor6 232

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 351≤1 km 196≤10 km 1 143>10 km 23

1 713 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence1 822

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	1 063
Helsinki, FI	415
Tartu, EE	30
ZMAAlocation not on record	30
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	20
SLU Artdatabankenlocation not on record	19
Durban Natural Science Museumlocation not on record	12
MZLUlocation not on record	11
DABUHlocation not on record	10
Provincia di Livornolocation not on record	10
Natural History Museum Rotterdamlocation not on record	9
Muzeum Górnośląskie w Bytomiulocation not on record	9
NTNU-VMlocation not on record	8
NHMOlocation not on record	5
Tallinn, EE	4
CBDClocation not on record	4
Uniwersytet Łódzkilocation not on record	4
Philadelphia, US	3
Kuopio, FI	3
Metsähallituslocation not on record	2
Zürich, CH	2
Podgorica, ME	2
Nijmegen, NL	2
МПХУlocation not on record	2
ИЗШ НАНУlocation not on record	2
ННПМ НАНУlocation not on record	1
Stockholm, SE	1
ЗММУlocation not on record	1
Ugentlocation not on record	1

29 institutions · 1 685 of 1 822 vouchered records shown · 137 without an institution code

09Environmental DNA11 detections

Where the DNA of Apamea oblonga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 5.30–17.3

Seasonal swing summer↔winter22.6 °C

Max temp (day)19.1 °C 8.20–20.0

Min temp (night)12.7 °C 1.90–14.9

Precipitation68.4 mm/mo 59.4–88.3

Air humidity62.4 % 59.1–65.7

Moisture balance-20.9 mm/mo

Vapour deficit692 Pa 373–740

Wind speed3.80 m/s

Cloud cover46.2 % 20.6–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apamea oblonga

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type8 112 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 112 records