Apamea devastator

Brace, 1819 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records4 019

Data sources7

Biological traits0

DNA specimens362

eDNA detections361

Sources7 archives

Databases and archives Apamea devastator's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 019 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI361 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics362 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 019 records

Environmental DNA1 datasets · 3 countries361 detections

DNA & barcodingBOLD362 specimens

01Narrative

Apamea devastator, the glassy cutworm, is a moth of the family Noctuidae. The moth is found in northeastern North America, including Nova Scotia, Alberta, New York, Ohio, and Massachusetts. The wingspan is 35 to 40 mm. The moth flies from May to September, depending on the location. The larva, a cutworm, feeds on various grasses. It is subterranean and attacks the roots and basal stems of its hosts.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding362 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea devastator has left across the world's sequence archives.

At a glance

DNA specimens362

BINs2

Marker genes1

eDNA detections361

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus341 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Gmostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

46Cmostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

59Cmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

90Cmostly conserved

91Tmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

99Gmostly conserved

292Cmostly conserved

634Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes16

BINs2

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea dubitanssame genus2.7%Apamea cogitatasame genus2.7%Apamea ferragosame genus2.9%Apamea kuusamoensissame genus3.0%Arenostola unicolorsame family3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 019 records

Wild obs. + sensor1 242

Museum / vouchered2 777

Range

Area of Occupancy AOO4 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 837≤1 km 115≤10 km 59>10 km 73

1 084 georeferenced · 158 without coordinates

Open the mapobservation + sensor1 242

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 396≤1 km 233≤10 km 634>10 km 117

1 380 georeferenced · 1 397 without coordinates

Open the institutions mapphysical evidence2 777

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	596
East Lansing, US	366
University of Alberta Museums (UAM)location not on record	231
Oregon State Arthropod Collectionlocation not on record	230
New Haven, US	202
University of Guelph, Centre for Biodiversity Genomicslocation not on record	154
St. Paul, US	150
Vernal, US	111
Royal Saskatchewan Museumlocation not on record	68
Edmonton, CA	55
Cleveland Museum of Natural History, OH (CLEV)location not on record	51
Denver, US	47
San Diego, US	34
WWUlocation not on record	29
University of California, Davislocation not on record	27
Santa Cruz, US	25
Awka, NG	20
Mississippi State, US	17
US	13
KWPlocation not on record	12
Brussels, BE	10
OSUClocation not on record	9
Toronto, CA	7
RBINS-Scientific Heritagelocation not on record	7
ASUlocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Cambridge, US	3
National Institute of Biological Resourceslocation not on record	3
Albuquerque, US	3
UDlocation not on record	3
SOVTlocation not on record	2
King Saud Universitylocation not on record	2
Philadelphia, US	2
Essig Museum of Entomologylocation not on record	1
University of Alaska Museumlocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1

36 institutions · 2 500 of 2 777 vouchered records shown · 277 without an institution code

09Environmental DNA361 detections

Where the DNA of Apamea devastator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found361

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 361 detections have coordinates

Open the map3 countries0

Temperate mixed forestRiparian Zone4. Native Grassland | 4.4. Temperate GrasslandGrassland4. Native GrasslandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 13.2–19.9

Seasonal swing summer↔winter26.5 °C

Max temp (day)24.6 °C 17.7–27.2

Min temp (night)14.0 °C 7.10–15.0

Precipitation49.1 mm/mo 29.6–96.6

Air humidity52.1 % 51.0–64.8

Moisture balance-85.7 mm/mo -121–-10.7

Vapour deficit931 Pa 608–1,117

Wind speed3.80 m/s 1.80–4.00

Cloud cover36.4 % 31.2–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 355 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apamea devastator

At a glance

Sources7 archives

At a glance

Record type4 019 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 019 records