Anyphaena pectorosa

L.Koch, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Anyphaena

At a glance

Occurrence records516

Data sources9

Biological traits3

DNA specimens348

eDNA detections347

Sources9 archives

Databases and archives Anyphaena pectorosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility516 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI347 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics348 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF516 records

Environmental DNA1 datasets · 2 countries347 detections

DNA & barcodingBOLD348 specimens

01Narrative

Anyphaena pectorosa is a species of ghost spider in the family Anyphaenidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1982

Morphometry3

Body length♀5·♂4.5 mm

Cephalothorax length♀1.95·♂1.96 mm

Cephalothorax width♀1.73·♂1.62 mm

05DNA & barcoding348 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anyphaena pectorosa has left across the world's sequence archives.

At a glance

DNA specimens348

BINs1

Marker genes1

eDNA detections347

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P646 bp consensus295 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

3Cmostly conserved

24Cmostly conserved

103Tmostly conserved

130Tmostly conserved

229Gmostly conserved

307Amostly conserved

356Amostly conserved

458Amostly conserved

492Gmostly conserved

541Avariable

592Tmostly conserved

TACTTTATATTTAATTTTTGGTGCTTGATCTGCTATAGTAGGAACTGCTATAAGAGTATTAATTCGAATGGAATTAGGACAATCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes23

BIN1

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anyphaena californicasame genus7.6%Anyphaena celersame genus8.3%Wulfila pulverulentussame family8.4%Anyphaena pacificasame genus8.7%Anyphaena apertasame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type516 records

Wild obs. + sensor9

Museum / vouchered507

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 3>10 km 2

5 georeferenced · 4 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 4≤10 km 6

10 georeferenced · 497 without coordinates

Open the institutions mapphysical evidence507

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	157
Ohio State University Acarology Laboratorylocation not on record	50
Cambridge, US	27
Chicago, US	22
Royal Ontario Museumlocation not on record	19
Biodiversity Institute of Ontariolocation not on record	9
Denver, US	3
Centre for Biodiversity Genomicslocation not on record	3
Albuquerque, US	2
US	1

10 institutions · 293 of 507 vouchered records shown · 214 without an institution code

09Environmental DNA347 detections

Where the DNA of Anyphaena pectorosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found347

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 347 detections have coordinates

Open the map2 countries0

Forest14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.4. Temperate ForestMixed habitatleaf with egg sacGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 7.50–22.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.9 °C 12.8–26.1

Min temp (night)14.2 °C 3.30–19.5

Precipitation87.9 mm/mo 79.7–98.1

Air humidity58.1 % 55.5–60.2

Moisture balance-40.8 mm/mo -67.2–-2.10

Vapour deficit855 Pa 441–1,144

Wind speed3.20 m/s 2.80–5.00

Cloud cover41.1 % 36.4–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 347 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)