Anyphaena aperta

(Banks, 1921) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Anyphaena

At a glance

Occurrence records53

Data sources8

Biological traits3

DNA specimens27

eDNA detections27

Sources8 archives

Databases and archives Anyphaena aperta's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD27 specimens

01Narrative

Anyphaena aperta is a species of ghost spider in the family Anyphaenidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1982

Morphometry3

Body length♀5.5·♂4.35 mm

Cephalothorax length♀2.38·♂2 mm

Cephalothorax width♀1.86·♂1.59 mm

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anyphaena aperta has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections27

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

22Gvariable

24Cvariable

163Tvariable

298Tvariable

479Amostly conserved

508Amostly conserved

544Avariable

AACTTTATATTTAATTTTTGGGGCTTGAGCTGCTATAGTAGGAACTGGAATAAGAGTATTAATTCGTATAGAATTAGGACAATCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes10

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anyphaena accentuatasame genus6.6%Anyphaena celersame genus7.3%Anyphaena sabinasame genus7.7%Anyphaena californicasame genus7.9%Anyphaena trifidasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor20

Museum / vouchered33

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 6≤1 km 5≤10 km 2>10 km 2

15 georeferenced · 5 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Buenos Aires, AR	2
Cambridge, US	1
Vancouver, CA	1
San Francisco, US	1

5 institutions · 12 of 33 vouchered records shown · 21 without an institution code

09Environmental DNA27 detections

Where the DNA of Anyphaena aperta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

Bog Forest, Cedar-salal Forestblanketbog;bedrock; sand beach;Riparian ZoneBedrock, Blanket BogForestWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.6–15.7

Seasonal swing summer↔winter10.9 °C

Max temp (day)16.4 °C 11.7–19.7

Min temp (night)10.2 °C 9.30–13.2

Precipitation57.1 mm/mo 32.9–156

Air humidity61.7 % 60.3–66.8

Moisture balance-37.6 mm/mo

Vapour deficit579 Pa 482–669

Wind speed3.50 m/s

Cloud cover41.0 % 31.9–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)