Anyphaena celer

(Hentz, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Anyphaena

At a glance

Occurrence records124

Data sources8

Biological traits11

DNA specimens45

eDNA detections45

Sources8 archives

Databases and archives Anyphaena celer's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility124 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

World Spider Trait DBMasaryk University11 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF124 records

Environmental DNA1 datasets · 1 countries45 detections

DNA & barcodingBOLD45 specimens

01Narrative

Anyphaena celer is a species of ghost spider in the family Anyphaenidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWolff et al. 2013Dondale & Redner 1982

Morphometry5

Body length♀5.17·♂4.35 mm

Cephalothorax length♀2·♂2.09 mm

Cephalothorax width♀1.48·♂1.59 mm

Claw tuft area0.01 mm

Claw tuft density2 653 mm

Predation2

Hunting guildother hunters

Web buildingno

Ecology4

Circadian activitynocturnal

Microhabitatfoliage, bark

Moisture 2semi-humid

Stratumshrub layer

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anyphaena celer has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes1

eDNA detections45

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

211Gvariable

268Amostly conserved

340Cmostly conserved

439Tmostly conserved

AACTTTATATTTAATTTTTGGTGCTTGGTCTGCTATAGTAGGAACTGCAATAAGAGTATTAATTCGAATAGAATTAGGTCAATCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes5

BIN1

Most divergent pair0.31%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anyphaena trifidasame genus6.9%Anyphaena apertasame genus7.3%Anyphaena californicasame genus7.7%Anyphaena pectorosasame genus8.3%Anyphaena accentuatasame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type124 records

Wild obs. + sensor3

Museum / vouchered121

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 5≤10 km 5>10 km 2

12 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	34
University of Guelph, Centre for Biodiversity Genomicslocation not on record	29
Biodiversity Institute of Ontariolocation not on record	8
Cambridge, US	5
Denver, US	4
Champaign, US	3
Albuquerque, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Cincinnati, US	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Royal Ontario Museumlocation not on record	1
Copenhagen, DK	1

12 institutions · 89 of 121 vouchered records shown · 32 without an institution code

09Environmental DNA45 detections

Where the DNA of Anyphaena celer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map1 country0

GrasslandMixed habitat1. Forest & WoodlandForestBeachRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 10.9–22.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)24.8 °C 13.8–26.7

Min temp (night)17.5 °C 8.90–18.6

Precipitation84.7 mm/mo 80.1–98.6

Air humidity59.1 % 57.4–60.3

Moisture balance-57.7 mm/mo -62.5–12.4

Vapour deficit989 Pa 521–1,115

Wind speed2.90 m/s 2.80–4.30

Cloud cover40.8 % 36.1–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)