Anyphaena sabina

L.Koch, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Anyphaena

At a glance

Occurrence records325

Data sources7

Biological traits8

DNA specimens24

eDNA detections25

Sources7 archives

Databases and archives Anyphaena sabina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility325 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

World Spider Trait DBMasaryk University8 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF325 records

Environmental DNA1 datasets · 4 countries25 detections

DNA & barcodingBOLD24 specimens

01Narrative

Anyphaena sabina is een spinnensoort in de taxonomische indeling van de buisspinnen (Anyphaenidae). Het dier behoort tot het geslacht Anyphaena. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1866 door Ludwig Carl Christian Koch.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMacías-Hernández et al. 2020

Morphometry6

Body length4.68 mm

Cephalothorax height0.545 mm

Cephalothorax length1.86 mm

Cephalothorax width1.46 mm

Fang length0.386 mm

Tibia I length2 mm

Ecology2

Circadian activity1 mm

Stratum0.5 mm

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anyphaena sabina has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections25

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

81Amostly conserved

102Tmostly conserved

159Amostly conserved

195Avariable

202Tmostly conserved

213Gmostly conserved

225Amostly conserved

255Cmostly conserved

262Tmostly conserved

264Amostly conserved

333Tmostly conserved

339Tmostly conserved

577Cmostly conserved

TTATATTTAATTTTTGGAGCTTGAGCTGCTATAGTAGGGACTGGAATAAGAGTTTTAATTCGAATAGAATTAGGACAATCAGGAAGATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes11

BIN1

Most divergent pair1.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anyphaena accentuatasame genus6.1%Anyphaena apertasame genus7.7%Anyphaena trifidasame genus9.1%Anyphaena celersame genus9.1%Anyphaena californicasame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type325 records

Wild obs. + sensor245

Museum / vouchered78

Other2

Range

Area of Occupancy AOO760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 55≤1 km 14≤10 km 106>10 km 5

180 georeferenced · 65 without coordinates

Open the mapobservation + sensor245

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 5≤10 km 35

40 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	4
Washington, US	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
South Kensington, GB	1

4 institutions · 10 of 78 vouchered records shown · 68 without an institution code

09Environmental DNA25 detections

Where the DNA of Anyphaena sabina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map4 countries0

City parks and large gardensPres humide de bord d'etangUrbanSuberaieSous-bois

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 4.30–19.5

Seasonal swing summer↔winter15.4 °C

Max temp (day)21.2 °C 6.80–24.5

Min temp (night)11.8 °C 1.70–14.7

Precipitation52.1 mm/mo 39.5–64.7

Air humidity58.3 % 52.4–66.6

Moisture balance-63.9 mm/mo -126–37.0

Vapour deficit860 Pa 276–1,045

Wind speed2.70 m/s 2.00–4.30

Cloud cover38.3 % 31.0–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)