Anyphaena pacifica

(Banks, 1896) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Anyphaena

At a glance

Occurrence records242

Data sources9

Biological traits3

DNA specimens77

eDNA detections69

Sources9 archives

Databases and archives Anyphaena pacifica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility242 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF242 records

Environmental DNA1 datasets · 2 countries69 detections

DNA & barcodingBOLD77 specimens

01Narrative

Anyphaena pacifica is a species of ghost spider in the family Anyphaenidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1982

Morphometry3

Body length♀5.45·♂5.6 mm

Cephalothorax length♀2.45·♂2.4 mm

Cephalothorax width♀1.79·♂2.03 mm

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anyphaena pacifica has left across the world's sequence archives.

At a glance

DNA specimens77

BINs1

Marker genes2

eDNA detections69

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

2Cmostly conserved

9Cvariable

66Tmostly conserved

75Amostly conserved

83Cmostly conserved

87Gvariable

126Cmostly conserved

132Tmostly conserved

144Amostly conserved

159Amostly conserved

262Tmostly conserved

267Amostly conserved

312Avariable

330Gvariable

336Tmostly conserved

342Amostly conserved

348Amostly conserved

411Tvariable

432Gmostly conserved

474Amostly conserved

537Avariable

624Avariable

ACTTTATACTTAATTTTTGGAGCATGATCTGCTATAGTTGGTACTGCAATAAGAGTTTTAATTCGTATAGAATTAGGACAATCAGGGAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes19

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anyphaena californicasame genus5.3%Anyphaena trifidasame genus8.5%Anyphaena apertasame genus8.5%Anyphaena pectorosasame genus8.7%Anyphaena accentuatasame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type242 records

Wild obs. + sensor8

Museum / vouchered234

Origin

Native22

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 4≤1 km 1>10 km 1

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 16≤1 km 3≤10 km 13>10 km 1

33 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	122
Albuquerque, US	24
Los Angeles, US	22
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
San Diego, US	5
Cambridge, US	4
Vancouver, CA	3
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	3
Chicago, US	2
San Francisco, US	2
Natural History Museum of Utahlocation not on record	2
University of Alberta Museums (UAM)location not on record	2
Buenos Aires, AR	1
US	1
Champaign, US	1

15 institutions · 212 of 234 vouchered records shown · 22 without an institution code

09Environmental DNA69 detections

Where the DNA of Anyphaena pacifica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest8. Desert | 8.1. Hot Desert1. Forest & Woodland|1.4. Temperate ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 10.9–18.1

Seasonal swing summer↔winter22.1 °C

Max temp (day)21.7 °C 15.6–25.7

Min temp (night)10.7 °C 5.10–16.1

Precipitation39.3 mm/mo 10.8–84.0

Air humidity52.2 % 45.8–66.3

Moisture balance-73.2 mm/mo

Vapour deficit846 Pa 465–1,090

Wind speed2.60 m/s

Cloud cover31.4 % 13.0–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)