Antrostomus vociferus

(A.Wilson, 1812) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Caprimulgiformes/Caprimulgidae/Antrostomus

At a glance

Occurrence records163 640

Data sources10

Biological traits35

DNA specimens7

eDNA detections12

Sources10 archives

Databases and archives Antrostomus vociferus's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility163 639 records↗

OBISOcean Biodiversity Information System1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF · OBIS163 640 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD7 specimens

01Narrative

The eastern whip-poor-will (Antrostomus vociferus) is a medium-sized (22–27 cm; 8.7-10.6 ins.) bird within the nightjar family, Caprimulgidae, from North America. The whip-poor-will is commonly heard within its range, but less often seen because of its camouflage. It is named onomatopoeically after its song.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAnAgeAVONETEltonTraits

Size & morphology13

Beak depth2.7 mm

Beak length (culmen)16.1 mm

Beak length (nares)6.7 mm

Beak width3.8 mm

Body mass54 g

Body mass (female)56.5 g

Body mass (male)50.3 g

Hand-wing index46.1

Kipp's distance72.3 mm

Secondary length84.4 mm

Tail length114 mm

Tarsus length15.1 mm

Wing length154 mm

Life cycle & reproduction11

Age at maturity (male)365 days

Age at sexual maturity365 days

Egg mass7 g

Fledging age20 days

Fledging mass52.8 g

Gestation19 days

Incubation19 days

Litter size2

Litters per year2 /year

Max. longevity180 months

Neonate mass5.4 g

Diet & foraging7

Ground20 %

Invertebrate100 %

Midhigh50 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory20 %

Water around surface10 %

Habitat & environment4

HabitatForest

Migration3.0

Primary lifestyleGeneralist

Range size3 403 565 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antrostomus vociferus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P696 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Diversity (π)3.6%

Haplotypes2

BIN1

Most divergent pair0.43%

Where individuals differ — all 78 variable positions, in barcode order

4Cmostly conserved

5Tmostly conserved

6Cvariable

7Tmostly conserved

8Amostly conserved

9Tmostly conserved

10Cmostly conserved

12Amostly conserved

13Amostly conserved

15Cmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Cmostly conserved

22Gmostly conserved

23Cmostly conserved

25Tmostly conserved

26Gmostly conserved

27Amostly conserved

29Cmostly conserved

30Tmostly conserved

31Gmostly conserved

32Gmostly conserved

33Cmostly conserved

34Amostly conserved

38Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Amostly conserved

43Amostly conserved

46Gmostly conserved

47Cmostly conserved

48Cmostly conserved

49Cmostly conserved

50Tmostly conserved

51Amostly conserved

52Amostly conserved

53Gmostly conserved

54Cmostly conserved

55Tmostly conserved

57Amostly conserved

58Cmostly conserved

60Tvariable

61Amostly conserved

62Tmostly conserved

64Cmostly conserved

65Gmostly conserved

66Cmostly conserved

68Cmostly conserved

70Gmostly conserved

71Amostly conserved

73Cmostly conserved

74Tmostly conserved

75Amostly conserved

76Gmostly conserved

77Gmostly conserved

78Cmostly conserved

80Amostly conserved

81Amostly conserved

82Cmostly conserved

83Cmostly conserved

84Cmostly conserved

85Gmostly conserved

86Gmostly conserved

87Amostly conserved

88Amostly conserved

89Cmostly conserved

93Cmostly conserved

94Cmostly conserved

95Tmostly conserved

98Gmostly conserved

99Amostly conserved

119Tmostly conserved

339Tmostly conserved

567Cmostly conserved

612Tmostly conserved

696Amostly conserved

ACCCTCTATCTAATCTTTGGCGCATGAGCTGGCATAGTAGGAACCGCCCTAAGCTTACTTATCCGCGCAGAACTAGGCCAACCCGGAACC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antrostomus arizonaesame genus2.3%Antrostomus carolinensissame genus8.4%Antrostomus rufussame genus8.4%Phalaenoptilus nuttalliisame family10.4%Setopagis parvulasame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type163 640 records

Wild obs. + sensor163 307

Museum / vouchered333

Origin

Native83

Range

Area of Occupancy AOO135 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 534≤1 km 1 031≤10 km 299>10 km 442

3 306 georeferenced · 160 001 without coordinates

Open the mapobservation + sensor163 307

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 2≤1 km 19≤10 km 136>10 km 31

188 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence333

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	104
New Haven, US	47
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	47
Wuzhou, CN	23
Albany, US	22
Texas Cooperative Wildlife Collectionlocation not on record	21
Berkeley, US	19
Seattle, US	18
Cambridge, US	7
Iowa City, US	7
Tacoma, US	6
Ciudad de México, MX	2
Geneva, CH	2
Ohio State University - Bird Division, Columbus, OH (OSUM)location not on record	2
Washington State University, Charles R. Conner Museumlocation not on record	1
Moore Laboratory of Zoology, Occidental Collegelocation not on record	1
Zacatecas, MX	1
München, DE	1
Louisiana State University, Museum of Zoologylocation not on record	1

19 institutions · 332 of 333 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Antrostomus vociferus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 8.50–20.8

Seasonal swing summer↔winter8.70 °C

Max temp (day)24.2 °C 11.4–26.2

Min temp (night)6.70 °C 3.20–18.1

Precipitation67.6 mm/mo 4.90–85.0

Air humidity59.1 % 39.9–60.4

Moisture balance-75.1 mm/mo -157–2.90

Vapour deficit905 Pa 490–1,082

Wind speed2.90 m/s 2.50–6.80

Cloud cover28.0 % 22.3–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antrostomus vociferus

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction11

Diet & foraging7

Habitat & environment4

At a glance

Record type163 640 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type163 640 records