Antrostomus rufus

(Boddaert, 1783) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Caprimulgiformes/Caprimulgidae/Antrostomus

At a glance

Occurrence records9 641

Data sources8

Biological traits19

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Antrostomus rufus's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 641 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF9 641 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD3 specimens

Genome at a glanceGoaT2n = 78

01Narrative

The rufous nightjar (Antrostomus rufus) is a species of nightjar in the family Caprimulgidae. It is found in Argentina, Bolivia, Brazil, Colombia, Costa Rica, Ecuador, Guyana, Panama, Paraguay, Peru, Saint Lucia, Suriname, Trinidad and Tobago, and Venezuela.Remsen, J. V., Jr., J. I. Areta, E. Bonaccorso, S. Claramunt, A. Jaramillo, D. F. Lane, J. F. Pacheco, M. B. Robbins, F. G. Stiles, and K. J. Zimmer. Version 24 August 2021. Species Lists of Birds for South American Countries and Territories. https://www.museum.lsu.edu/~Remsen/SACCCountryLists.htm retrieved August 24, 2021

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAVONETAmnioteDB

Size & morphology11

Beak depth3.8 mm

Beak length (culmen)26.3 mm

Beak length (nares)10.1 mm

Beak width6 mm

Body mass94.2 g

Hand-wing index46.1

Kipp's distance77.8 mm

Secondary length91.2 mm

Tail length116 mm

Tarsus length18.4 mm

Wing length169 mm

Life cycle & reproduction2

Egg mass9.7 g

Litter size1.5

Diet & foraging2

Trophic levelcarnivore

Trophic nicheInvertivore

Habitat & environment4

HabitatWoodland

Migration1.0

Primary lifestyleGeneralist

Range size5 391 691 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antrostomus rufus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.21%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 2 variable positions, in barcode order

9Cvariable

366Gvariable

ATCTTTGGCGCATGAGCCGGCATAGTAGGAACCGCCCTAAGCCTACTCATCCGTGCAGAACTAGGCCAACCCGGAACCCTCTTAGGAGAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antrostomus carolinensissame genus5.3%Phalaenoptilus nuttalliisame family7.8%Antrostomus arizonaesame genus8.1%Antrostomus vociferussame genus8.4%Nyctidromus albicollissame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Antrostomus rufus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 78 n = 39

Chromosome records78–782n range78median78mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 782×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

08Occurrence & distribution

Record type9 641 records

Wild obs. + sensor9 620

Museum / vouchered21

Origin

Native67

Range

Area of Occupancy AOO9 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 68≤1 km 55≤10 km 20>10 km 4

147 georeferenced · 9 473 without coordinates

Open the mapobservation + sensor9 620

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	6
Louisiana State University, Museum of Zoologylocation not on record	4
Geneva, CH	2
Berkeley, US	2
Stockholm, SE	1
Wuzhou, CN	1
Seattle, US	1
Ann Arbor, US	1
Departamento de Sistematica e Ecologialocation not on record	1

9 institutions · 19 of 21 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Antrostomus rufus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 25.3–25.4

Seasonal swing summer↔winter2.70 °C

Max temp (day)29.3 °C 29.1–29.5

Min temp (night)21.7 °C 20.9–22.5

Precipitation86.9 mm/mo 75.4–98.3

Air humidity59.6 % 56.3–62.9

Moisture balance-55.7 mm/mo -65.2–-46.1

Vapour deficit1,313 Pa 1,207–1,419

Wind speed1.90 m/s 1.90–2.00

Cloud cover27.2 % 21.6–32.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antrostomus rufus

At a glance

Sources8 archives

Size & morphology11

Life cycle & reproduction2

Diet & foraging2

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type9 641 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 641 records