Antrostomus arizonae

Animalia/Chordata/Aves/Caprimulgiformes/Caprimulgidae/Antrostomus

At a glance

Occurrence records27 986

Data sources7

Biological traits28

DNA specimens5

eDNA detections0

Sources7 archives

Databases and archives Antrostomus arizonae's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 986 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources28 traits

Occurrence & distributionGBIF27 986 records

DNA & barcodingBOLD5 specimens

01Narrative

The Mexican whip-poor-will, (Antrostomus arizonae), is a medium-sized nightjar of the southwestern United States, Mexico, and northern Central America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONET

Size & morphology13

Beak depth3 mm

Beak length (culmen)22.1 mm

Beak length (nares)7.7 mm

Beak width4.4 mm

Body mass54 g

Body mass (female)56.5 g

Body mass (male)50.3 g

Hand-wing index48.3

Kipp's distance76.9 mm

Secondary length82.4 mm

Tail length112 mm

Tarsus length16.8 mm

Wing length159 mm

Life cycle & reproduction9

Age at maturity (male)365 days

Age at sexual maturity365 days

Egg mass7 g

Fledging age20 days

Incubation19 days

Litter size2

Litters per year2 /year

Max. longevity180 months

Neonate mass5.4 g

Diet & foraging2

Trophic levelcarnivore

Trophic nicheInvertivore

Habitat & environment4

HabitatForest

Migration3.0

Primary lifestyleGeneralist

Range size1 013 761 km²

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antrostomus arizonae has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.32%

Haplotypes2

BIN1

Most divergent pair0.58%

Where individuals differ — all 5 variable positions, in barcode order

58Tmostly conserved

103Cmostly conserved

181Amostly conserved

211Tmostly conserved

574Gvariable

CCTCTATCTAATCTTTGGCGCATGAGCTGGCATAGTAGGAACCGCCCTAAGCTTACTTATCCGCGCAGAACTAGGCCAACCCGGAACCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antrostomus vociferussame genus2.3%Antrostomus rufussame genus8.1%Antrostomus carolinensissame genus8.1%Phalaenoptilus nuttalliisame family10.2%Chordeiles nacundasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type27 986 records

Wild obs. + sensor27 759

Museum / vouchered227

Origin

Native13

Range

Area of Occupancy AOO10 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 254≤1 km 109≤10 km 51>10 km 21

435 georeferenced · 27 324 without coordinates

Open the mapobservation + sensor27 759

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 121≤1 km 5≤10 km 46>10 km 2

174 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence227

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moore Laboratory of Zoology, Occidental Collegelocation not on record	56
Ciudad de México, MX	30
Seattle, US	19
Morelia, MX	16
Wuzhou, CN	11
Zacatecas, MX	11
Delaware Museum of Nature and Sciencelocation not on record	10
Louisiana State University, Museum of Zoologylocation not on record	10
South Kensington, GB	10
Mexico City, MX	7
St. Paul, US	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Washington, US	4
München, DE	3
Mexico City, MX	3
US	3
Ann Arbor, US	2
	2
Texas Cooperative Wildlife Collectionlocation not on record	2
Tuxtla Gutiérrez, MX	1
Universidad Católica de Manizaleslocation not on record	1
Cambridge, US	1
Sistema de Colecciones Biológicas, Escuela de Biología, Universidad de San Carlos de Guatemala location not on record	1
Toronto, CA	1
Arizona State University Biocollectionslocation not on record	1

25 institutions · 215 of 227 vouchered records shown · 12 without an institution code

At a glance

Sources7 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging2

Habitat & environment4

At a glance

Record type27 986 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 25 geolocated

Record type27 986 records