Antrostomus carolinensis

(J.F.Gmelin, 1789) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Caprimulgiformes/Caprimulgidae/Antrostomus

At a glance

Occurrence records140 813

Data sources10

Biological traits26

DNA specimens6

eDNA detections1

Sources10 archives

Databases and archives Antrostomus carolinensis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 813 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources26 traits

Occurrence & distributionGBIF140 813 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT≈1.1 Gbp

01Narrative

The chuck-will's-widow (Antrostomus carolinensis) is a nocturnal bird of the nightjar family Caprimulgidae. It is found in the southeastern United States near swamps, rocky uplands, and pine woods. It migrates to the West Indies, Central America, and northwestern South America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONET

Size & morphology13

Beak depth4 mm

Beak length (culmen)15.2 mm

Beak length (nares)7.5 mm

Beak width6.2 mm

Body mass115 g

⚠ sources differ — AmnioteDB: 115 g · AVONET: 109 g

Body mass (female)108 g

Body mass (male)110 g

Hand-wing index51.5

Kipp's distance106 mm

Secondary length100 mm

Tail length141 mm

Tarsus length17.5 mm

Wing length208 mm

Life cycle & reproduction6

Egg mass12.8 g

Fledging age17 days

Incubation20 days

Litter size2

Litters per year1 /year

Max. longevity178 months

Diet & foraging2

Trophic levelcarnivore

Trophic nicheInvertivore

Habitat & environment4

HabitatWoodland

Migration3.0

Primary lifestyleAerial

Range size1 808 676 km²

Other traits1

Interbirth interval365 days

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antrostomus carolinensis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

16Gvariable

CACCCTCTATCTAATGTTCGGCGCATGAGCAGGCATAGTAGGAACCGCCCTAAGTCTGCTCATCCGTGCAGAACTAGGCCAACCCGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antrostomus rufussame genus5.3%Phalaenoptilus nuttalliisame family7.3%Antrostomus arizonaesame genus8.1%Antrostomus vociferussame genus8.4%Nyctidromus albicollissame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Antrostomus carolinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 118 829 799 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Antrostomus carolinensis1.12 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness86.9% BUSCO

08Occurrence & distribution

Record type140 813 records

Wild obs. + sensor140 490

Museum / vouchered323

Origin

Native104

Range

Area of Occupancy AOO99 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 2 011≤1 km 618≤10 km 161>10 km 430

3 220 georeferenced · 137 270 without coordinates

Open the mapobservation + sensor140 490

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 5≤1 km 14≤10 km 104>10 km 57

180 georeferenced · 143 without coordinates

Open the institutions mapphysical evidence323

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Texas Cooperative Wildlife Collectionlocation not on record	58
Ann Arbor, US	57
Seattle, US	51
New Haven, US	29
Wuzhou, CN	21
Berkeley, US	20
Tacoma, US	12
Universidad Nacional de Colombia (UNAL)location not on record	9
Iowa City, US	7
Louisiana State University, Museum of Zoologylocation not on record	7
Cambridge, US	7
Zacatecas, MX	5
Geneva, CH	5
Albany, US	3
ASNHClocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Washington State University, Charles R. Conner Museumlocation not on record	3
Moore Laboratory of Zoology, Occidental Collegelocation not on record	3
Pontificia Universidad Javeriana (PUJ)location not on record	2
Universidad Católica de Manizaleslocation not on record	2
Ohio State University - Bird Division, Columbus, OH (OSUM)location not on record	2
Brussels, BE	2
Jurica-Suchy Nature Museumlocation not on record	2
Universidad de Caldas (UCaldas)location not on record	1
RBINS-Scientific Heritagelocation not on record	1
München, DE	1
Ithaca, US	1
Universidad Industrial de Santander (UIS)location not on record	1
Universidad del Valle (UniValle)location not on record	1

29 institutions · 319 of 323 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Antrostomus carolinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antrostomus carolinensis

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction6

Diet & foraging2

Habitat & environment4

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type140 813 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type140 813 records