Antipodia chaostola

(Meyrick, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Antipodia

At a glance

Occurrence records414

Data sources7

Biological traits0

DNA specimens5

eDNA detections3

Sources7 archives

Databases and archives Antipodia chaostola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility414 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF414 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD5 specimens

01Narrative

Antipodia chaostola, the chaostola skipper, is a butterfly of the family Hesperiidae. It is found in Australia along the coast of Victoria, New South Wales and Tasmania. The wingspan is about 30 mm. The larvae feed on Cyperaceae species, including Gahnia filifolia, Gahnia grandis, Gahnia microstachya, Gahnia radula and Gahnia sieberiana.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antipodia chaostola has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGATCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisynta cynonesame family7.2%Thymelicus sylvestrissame family7.5%Anisynta sphenosemasame family7.8%Anisynta monticolaesame family7.9%Anisynta dominulasame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type414 records

Wild obs. + sensor162

Museum / vouchered248

Other4

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 51≤1 km 33≤10 km 68

152 georeferenced · 10 without coordinates

Open the mapobservation + sensor162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 25≤10 km 101>10 km 5

132 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	190
Tasmanian Museum & Art Gallerylocation not on record	33
Cambridge, US	9
QVMAGlocation not on record	6
Natick, US	5
Australian National Insect Collectionlocation not on record	2
Sydney, AU	2

7 institutions · 247 of 248 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Antipodia chaostola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.6–15.6

Seasonal swing summer↔winter10.5 °C

Max temp (day)20.8 °C

Min temp (night)10.9 °C

Precipitation81.3 mm/mo

Air humidity58.9 %

Moisture balance-59.6 mm/mo

Vapour deficit727 Pa

Wind speed4.20 m/s

Cloud cover25.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)