Anisynta cynone

(Hewitson, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Anisynta

At a glance

Occurrence records751

Data sources6

Biological traits0

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Anisynta cynone's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility751 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF751 records

DNA & barcodingBOLD6 specimens

01Narrative

Anisynta cynone, the mottled grass-skipper or cynone skipper, is a butterfly of the family Hesperiidae. It is found in the Australian states of New South Wales, Victoria and South Australia. The wingspan is about 20 mm. The larvae feed on Poa species, such as Poa sieberiana, and Brachypodium distachyon, Cynodon dactylon, Austrostipa scabra and Oryzopsis miliacea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisynta cynone has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.38%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

90Tmostly conserved

93Amostly conserved

144Cmostly conserved

280Amostly conserved

339Tmostly conserved

ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTATATTAATTCGAACAGAATTAGGTAATCCAGGATCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisynta monticolaesame genus2.3%Anisynta sphenosemasame genus4.0%Dispar compactasame family5.6%Anisynta dominulasame genus5.8%Motasingha trimaculatasame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type751 records

Wild obs. + sensor266

Museum / vouchered485

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 24≤1 km 12≤10 km 221

257 georeferenced · 9 without coordinates

Open the mapobservation + sensor266

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤1 km 8≤10 km 286>10 km 1

296 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence485

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	360
Sydney, AU	33
Tasmanian Museum & Art Gallerylocation not on record	25
Natick, US	23
Cambridge, US	21
Australian National Fish Collectionlocation not on record	9
Western Australian Museumlocation not on record	7
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	3
Australian National Insect Collectionlocation not on record	2

9 institutions · 483 of 485 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)