Anisynta sphenosema

(Meyrick & Lower, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Anisynta

At a glance

Occurrence records367

Data sources7

Biological traits0

DNA specimens6

eDNA detections4

Sources7 archives

Databases and archives Anisynta sphenosema's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility367 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF367 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Anisynta sphenosema, the wedge grass-skipper or wedge skipper, is a butterfly of the family Hesperiidae. It is found in the south-west quarter of Australia. The wingspan is about 30 mm. The larvae feed on various grasses, including Microlaena stipoides, Ehrharta calycina and Ehrharta longiflora.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisynta sphenosema has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes2

BINs2

Most divergent pair4.6%

Where individuals differ — all 30 variable positions, in barcode order

19Cmostly conserved

34Amostly conserved

145Tmostly conserved

154Tmostly conserved

181Amostly conserved

214Amostly conserved

220Cmostly conserved

274Tmostly conserved

346Cmostly conserved

358Cmostly conserved

364Tmostly conserved

376Cmostly conserved

379Amostly conserved

400Tmostly conserved

403Tmostly conserved

406Cmostly conserved

412Tmostly conserved

439Cmostly conserved

478Cmostly conserved

506Gmostly conserved

514Amostly conserved

526Tmostly conserved

539Cmostly conserved

592Tvariable

607Tvariable

613Cvariable

616Cvariable

622Avariable

631Avariable

634Tvariable

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTATATTAATTCGAACAGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisynta monticolaesame genus4.0%Anisynta cynonesame genus4.0%Dispar compactasame family5.9%Anisynta dominulasame genus6.1%Hesperilla crypsargyrasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type367 records

Wild obs. + sensor103

Museum / vouchered264

Range

Area of Occupancy AOO412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 37≤1 km 20≤10 km 4>10 km 15

76 georeferenced · 27 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 2>10 km 20

22 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence264

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	109
Museums Victorialocation not on record	108
Natick, US	21
Cambridge, US	18
Tasmanian Museum & Art Gallerylocation not on record	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Australian National Insect Collectionlocation not on record	1

7 institutions · 261 of 264 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Anisynta sphenosema was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.4–19.8

Seasonal swing summer↔winter11.6 °C

Max temp (day)24.9 °C 24.5–24.9

Min temp (night)14.8 °C 14.5–14.8

Precipitation38.9 mm/mo 38.9–40.7

Air humidity53.8 % 53.8–53.9

Moisture balance-48.5 mm/mo -60.3–-48.5

Vapour deficit1,061 Pa 1,042–1,061

Wind speed2.20 m/s 2.20–3.30

Cloud cover21.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)