Anisynta monticolae

(Olliff, 1890) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Anisynta

At a glance

Occurrence records421

Data sources7

Biological traits0

DNA specimens4

eDNA detections5

Sources7 archives

Databases and archives Anisynta monticolae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF421 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD4 specimens

01Narrative

Anisynta monticolae, the montane grass-skipper or mountain skipper, is a butterfly of the family Hesperiidae. It is found in Australia from the mountains of New South Wales and Victoria. The wingspan is about 20 mm. The larvae feed on Poaceae species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisynta monticolae has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.91%

Haplotypes2

BIN1

Most divergent pair1.4%

Where individuals differ — all 9 variable positions, in barcode order

31Avariable

82Cvariable

112Tvariable

181Avariable

217Avariable

343Cvariable

437Avariable

562Avariable

619Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTATATTAATTCGAACAGAGTTAGGTAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisynta cynonesame genus2.3%Anisynta sphenosemasame genus4.0%Dispar compactasame family5.6%Anisynta dominulasame genus6.5%Motasingha trimaculatasame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type421 records

Wild obs. + sensor199

Museum / vouchered222

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 16≤1 km 173≤10 km 6>10 km 2

197 georeferenced · 2 without coordinates

Open the mapobservation + sensor199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 2≤10 km 17>10 km 9

28 georeferenced · 194 without coordinates

Open the institutions mapphysical evidence222

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	183
Cambridge, US	21
Sydney, AU	6
Natick, US	5
Western Australian Museumlocation not on record	2
Tasmanian Museum & Art Gallerylocation not on record	2
Australian National Insect Collectionlocation not on record	1

7 institutions · 220 of 222 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Anisynta monticolae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 15.0–18.2

Seasonal swing summer↔winter14.0 °C

Max temp (day)22.6 °C 21.0–24.1

Min temp (night)11.1 °C 9.30–12.8

Precipitation59.6 mm/mo 55.8–63.4

Air humidity56.2 % 55.6–56.9

Moisture balance-82.6 mm/mo -89.9–-75.3

Vapour deficit836 Pa 761–910

Wind speed2.70 m/s 2.50–2.80

Cloud cover21.5 % 20.7–22.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)