Anthophora vestita

Smith, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records440

Data sources6

Biological traits0

DNA specimens12

eDNA detections9

Sources6 archives

Databases and archives Anthophora vestita's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility440 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF440 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anthophora vestita is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1854 door Smith. De diersoort komt voor in Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora vestita has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)3.7%

Haplotypes2

BINs2

Most divergent pair1.4%

Where individuals differ — all 88 variable positions, in barcode order

1Amostly conserved

16Tmostly conserved

22Gmostly conserved

43Gmostly conserved

46Tmostly conserved

52Avariable

55Tmostly conserved

79Amostly conserved

81Tmostly conserved

85Amostly conserved

88Gmostly conserved

89Gmostly conserved

99Gmostly conserved

103Tmostly conserved

109Gmostly conserved

112Tmostly conserved

130Amostly conserved

139Cmostly conserved

145Amostly conserved

160Amostly conserved

169Tmostly conserved

181Tvariable

190Tmostly conserved

196Gmostly conserved

197Tvariable

199Gmostly conserved

205Gmostly conserved

217Amostly conserved

223Tmostly conserved

235Tmostly conserved

238Amostly conserved

239Cmostly conserved

241Amostly conserved

262Amostly conserved

265Amostly conserved

268Amostly conserved

271Tmostly conserved

272Cmostly conserved

280Amostly conserved

286Gmostly conserved

289Gmostly conserved

298Amostly conserved

311Gmostly conserved

316Avariable

319Cmostly conserved

322Tmostly conserved

337Tmostly conserved

340Tmostly conserved

343Tmostly conserved

346Gmostly conserved

347Tmostly conserved

375Cmostly conserved

379Tmostly conserved

382Tmostly conserved

391Tmostly conserved

412Tmostly conserved

415Amostly conserved

419Tmostly conserved

436Tvariable

439Amostly conserved

451Amostly conserved

466Amostly conserved

469Amostly conserved

472Tmostly conserved

478Tmostly conserved

481Amostly conserved

493Amostly conserved

494Amostly conserved

511Gmostly conserved

514Amostly conserved

526Tmostly conserved

528Cmostly conserved

529Tmostly conserved

535Amostly conserved

548Tmostly conserved

550Amostly conserved

553Tmostly conserved

559Amostly conserved

561Cmostly conserved

562Cvariable

574Tmostly conserved

580Amostly conserved

598Gmostly conserved

607Cmostly conserved

616Tmostly conserved

631Tvariable

634Cvariable

646Cvariable

AATAATTTATTTTATTTTTGCGTTATGGGCAGGGATAATTGGGACTTCTATAAGTATAATTATTCGAATGGAATTGAGAGTTCCAGGGGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora edwardsiisame genus10.9%Anthophora rogenhoferisame genus10.9%Anthophora disparsame genus11.0%Anthophora pubescenssame genus11.4%Anthophora wartmannisame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type440 records

Wild obs. + sensor14

Museum / vouchered426

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 2>10 km 2

6 georeferenced · 420 without coordinates

Open the institutions mapphysical evidence426

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	219
Atlantic Reference Centrelocation not on record	51
Cape Town, ZA	50
ARC-Plant Protection Research Institute, National Collection of Fungi: Culture Collectionlocation not on record	50
Durban Natural Science Museumlocation not on record	32
	13
Cambridge, US	4
Beltsville, US	3
Wuzhou, CN	2
York University, Packer Collectionlocation not on record	1
Agricultural Research Council, South Africalocation not on record	1

11 institutions · 426 of 426 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Anthophora vestita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 19.6–22.8

Seasonal swing summer↔winter7.90 °C

Max temp (day)25.0 °C 23.9–27.3

Min temp (night)15.2 °C 15.1–19.1

Precipitation68.4 mm/mo 46.4–105

Air humidity63.6 % 56.9–64.2

Moisture balance-49.8 mm/mo

Vapour deficit852 Pa 825–1,188

Wind speed3.00 m/s

Cloud cover22.6 % 22.1–32.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)