Anthophora edwardsii

Cresson, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records568

Data sources6

Biological traits1

DNA specimens23

eDNA detections22

Sources6 archives

Databases and archives Anthophora edwardsii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF568 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anthophora edwardsii is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1878 door Cresson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)4.08 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora edwardsii has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

163Gmostly conserved

268Gmostly conserved

505Gmostly conserved

524Tmostly conserved

577Tmostly conserved

580Cmostly conserved

TATAATTATTCGAATAGAATTAAGAGTTCCGGGAATATGAATTAATAATGATCAAGTTTACAATTCAATTGTAACAGTTCATGCATTTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes5

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora senescenssame genus8.9%Anthophora disparsame genus8.9%Anthophora agamasame genus9.0%Anthophora romandiisame genus9.1%Anthophora canescenssame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type568 records

Wild obs. + sensor55

Museum / vouchered513

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 25≤1 km 14≤10 km 4>10 km 1

44 georeferenced · 11 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 5≤1 km 8≤10 km 70>10 km 14

97 georeferenced · 416 without coordinates

Open the institutions mapphysical evidence513

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	220
University of California, Davislocation not on record	78
	52
Wuzhou, CN	45
University of Alabamalocation not on record	32
Cambridge, US	17
Champaign, US	17
Santa Barbara Museum of Natural Historylocation not on record	7
US	6
Weber State University, Bird and Mammal Collectionlocation not on record	5
Natural History Museum of Utahlocation not on record	5
WSUClocation not on record	4
OSUClocation not on record	4
Oregon State Arthropod Collectionlocation not on record	4
San Diego, US	4
University of Central Floridalocation not on record	3
Chicago, US	2
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
ASUlocation not on record	1
US	1
Oregon State University, Oregon State Arthropod Collectionlocation not on record	1
University of California, Riverside, Entomology Research Museumlocation not on record	1
Santa Cruz, US	1
Universidad Católica de Manizaleslocation not on record	1

24 institutions · 513 of 513 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Anthophora edwardsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.50 °C 9.00–13.0

Seasonal swing summer↔winter12.8 °C

Max temp (day)12.7 °C 10.6–19.5

Min temp (night)7.60 °C 6.10–9.70

Precipitation50.5 mm/mo 39.1–88.0

Air humidity59.9 % 53.7–60.7

Moisture balance-37.3 mm/mo -93.3–-6.80

Vapour deficit478 Pa 450–756

Wind speed3.80 m/s 2.70–4.30

Cloud cover44.5 % 39.4–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)